Description :
From Genome Similarity Track
Location :
Scaffold_59:328- 4288
Transcript NameFunction/comments
Phymu_g3026pleiotropic drug resistance protein ABC superfamily

Sequence
3960 bases(100 bases per row)
AAAACTGGCTGTTTAACAGTTGACTTTGCTTTGGTATTCCATAGAAGTTTCGCTTTGTAATACAGTTATTAAAATATGAAGGCTGCTTGTCACATGGAGC
TGTGACGGGCGATGGATGTGTATTAAGTCGACTAGGCGAAGTGCTAGCAAAATTGctgtcagcagcagcgaatcGACTCGCGAGTGCACCTTTGCGATGG
CCTAAACGTACCATATACAGAGAGTCTTGCCTTGCCATTGCACTGCAGTTTACAGCCGTCGGTTGGCCCCGCGTCGCGTGGTAACGGGTCTCACCAGAAA
GACCCCGTGCACAGGTGATGAACAGCCGGTTCATCCTATCTTTTGCGCGGATGAACACGTCAGTCATCGCATTTCCACTGGTGGACGAACGCGACTccgt
tgaagacgatctTCACGCCCTTGACGTCTTTAGAATGCAAGGTCAGCGGCAAAGAGGAGTTAGCCTGAAGAGAAGCTGCGTTAACTGCCTTGCGGGCTTA
AATTACAGAATCGCAGGCAGAACGGACCTGTCCTGTATAGATTTGCGATTCGGTGCAACCTGAAGTTGCTTTTTGTGGCGGAACTGGCCGTGCTGGCCGG
TATTGGACAAGTGCCGAAGCGTGAAGAGAGAGCAGTTTGAGATTTCAGCCCGAATTGCTTAAGTCAACGCAAATATCATCTTCACGTACAGTTGACAAGA
GCACTTTTGGGGCGAGGTTTTATCATTGGCATGAATTCGGAACCGTAGATCTTTGGGCATGTAGTTCGTTAAATGCTGCCCGTTGAATCGTTTGTGGGAA
TTGCTGATgagtgtacatgtaccgccACCACCTTGTCACAGATACTGCTTCTAGCATTCCTCGATTCGCTTCGTGGATGTCAGCGGCACAGACAGCTTTC
GACCATGGCCGAACCGATAGATGCAAAGCCCAAGTTGGGTCTCGAGTCCGGTCAAATGCTCATGGCTCAGGGTGAAGCTGCCTTCCACGAtctcgtcgtg
cagcagctcgaaccAGCTCTAGGACGCCTCCTACCGCAGATGGAAGTACGTTGCAAGAGTTTGTCGGTCGTCGCTCAAGTGCCAGTGGTGAAgcagtcgt
ccagctcgacATCCGAGCTACCGTCCGTGTACAACAGTCTCAAGCACGCAGTACGGGAACTCACAGCAACCAGACAGACCACTGAACGAAATGTACTGAA
TCAAATCGACGCTGTGTTCGAACCGGGTACAATCACGCTGATCCTCGGCCAACCCGGTTcgggcaagacgacgctcaTGAAAGTACTGAGTGGCCAATTC
CCCCTTTCCAAGAACGTCACGATCCAAGGTGACGTCGCGTACAACGGGCAACCGTGGAAGGAGCTACTCCCAAAGCTCCCCCAGCTCTCAGCGTACGTTC
CTCAGACAGACACCCACTTCCCGTCATTATCCGTGCAAGAAACTCTGGAATTCGCCCATGCGTGTTGCACTGAAGAGTTCACTTTGAAACGTGGGAAGGG
TCTGCTATCAAACGGCACGCCCGAGCAGAACCAAGAGGCTCTACGTGTGATAGAAGCACTCGACAAACACTACCCGGAAGTGGTCGTCGAGCAACTTGGC
CTTAAAAACTGTCGAGACACTGTCATTGGCAATGCATTGAACCGTGGAGTATCCGGGGGCGAACGGCGACGCGTGACCATGGGGGAAATGGAGTTCGGAA
TGAAATACGCGACGTTCCTGGACGAAGTGACAAACGGATTGGACAGCGCTGCCACGTTCGACATCGTCTGCACACAGCGAGACATCGCCAAGAAACTGca
caagacggtggtgatggcgttACTGCAACCGGCACCCGAGGTCTTCGAACTCTTCGACAacgttctgctgctcaatgacGGCGAAGTGATGTACAATGGA
CCTCGTGAACAAGCGGTACCGTACTTCGAAAGCCTGGGCTTCGTATGCCCTCCCGACAGGGATGTCGCGGACTTCTTAATGGATCTCGGCACGgaccagc
agtaccagtacgAGGCGAAGCCAAACACCGGTTCTCCTCGGTTGGCGAGTGAATTTGCGGACCTCTTTCGCCAGTCTGCCACCCACCAGAATCTACTACA
AGCGCTCGAGACACCTTGGAGTAAGGACCGCTTGTATGATGCCGAAGAACACCTTGCCAAGATGACACAGTTCCGGCAGTCGTTGTGGGCGAGTGCCTTG
GCGTTGACGCGCCGGCATTTGACCATCGCAATGCGCAACGCCGCGTTTATCCGCGTGCGAACGTTCATGGTTGTGGCTATGGGGCTCGTGTACGGTAGTA
CGTTCTACGACTTCGATCCGACCAGCGCACAGGTAGCGCTGGGAGTACTCTACCAGACCACCATGTTCCTGGCGTTGGGGCAGGCGTCTCAGATGCCCGT
CTTCGTTGCGTCTCGGGATATCTACTACAAACACCGGAGAGCCAACTTCTACCGCTCGCTTTCGTTCGGAATCGCAAGTTTAGCTGCGTTGTTCCCCCCT
GCGGCTACTGAGTCAATCGTCTTTGGGACGTTCGTGTACTGGATGGTGGGCTTCGTAACAGAGGCGAGCTACtacctgctcttcctgctctgtATGATCC
TGACCAACCTCGCACTATGTGCGTGGTTCTTCACGCTGACCGCCATGTCGCCGAATTTCAACATCGCCAAGCCAATgtccacgttctccatctcgctcTA
CGTCCTCTTCGCGGGTTTTGTGGTCCCAAGGAGTCAGCTACCGCATTTCCTCGTGTGGATCTACTGGATCAACCCGGTCTCGTGGTGCTTGAGAACGCTG
GCTGTGAATCAATACCGCTCGCCTAAGTTCGACGTGTGCGTgtacgacggagaagacTACTGCGCCCGATACGACATGACCATGGGCGAATACTCGCTGT
CGCTCTACGATGTGCCTTCGGACAAGTCGTGGGTCTGGTTGGGAGTACTCTACCTCATGttctccgtcgtcttcttcgtagtGGTTGGTAGTTTCATACT
CGAGTACAAGCGCTATGACGTCCCTgacgctgtggctgttgttgccATAAATGAAGACCCACACAGAGAGAAGGAACAGCATGGAAACTCCACGAACTAC
GCTGAGGTCCACACGCCACGCTCTGCCTCCAATGCAGTCGATATGGTTGTTTTAgacctggacgagcaggacaGATTCGTACCTGTTACTCTGGCCTTCA
AGGACCTCTGGTATTCCGTGCCTCTGCCCCACCACAAGCACGAATCCATCGACCTGCTTAAGGGGATCAGTGGATACGCTCTGCCTGGCACCATGACGGC
GCTGATGGGGTCTTCAGGTGCAGGTAAAACGACTCTCATGGACGTGATTGCCTGTCGAAAGACCGGAGGTACCATCAAGGGAGAGATCCTGCTCAACGGA
TACCCCGCCACGGAGTTGGCGATCCGACGGTGTACAGGTTACTGCGAGCAGCAAGATGTTCACTCGGAAGGAGCAACAATCCGAGAAGCGCTCACCTTCA
GCGCTTTTCTTCGCCAGGACAGCAGCGTATCAGAACGAGCCAAGCTCGCATCGGTGGAGGAATGTCTGGACTTGTTGGATATGCGCGCCATCGCGGACCA
GATCATCCGAGGTCGATCCCAagagcagatgaagcgcctgACCATCGGTGTAGAGCTTGCAGCACAACCGAGtgtgctgttcctggatgAACCTACCAGT
GGTCTGGACGCTCACTCCGCCAAGGTCATCATGGATGGGGTCCGCAAAGTGGCTGACAGTGGCCGAACGGTTGTGTgtacgatccaccagccttcgtccg
acgtcttcttcctgttcgacaGTCTCCTGCTACTGAAACGTGGTGGTGAGatggtcttcttcggggAACTCGACAACGCGCAGCCGGATGATCGCGAatg
cagccacttgatcgACTACTTCGAAGCCATTCCGGAGATCGCCCGTTTGCCTGAGGGTCA