Description :
From Genome Similarity Track
Location :
Scaffold_2344:328- 3046
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_2344-snap-gene-0.1Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_2344-snap-gene-0.2Conserved gene of unknown function

Sequence
2718 bases(100 bases per row)
GGCCCAAGAAGCCGAGGAGTACGACCGCTTACGGCGCCAAGAGGAATCGTCCATGGAGCGCATCCGCGTGATCCAGCAGGAGCACCCAAAGCGCGAGGAG
ATCCGACAGACGCTGCAGCGGTTCTATCACAGCGAAGGTAACCTGAGCGGGTTGTTGACAGAGGAAATCGCCGAAGGGAGTGGTCGGCTGAGTCGAAACA
CGAGCAGTTTTGCGGACGATCTCGACGACGAAGCGGACGAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTGGAGATACACCGCGGGATCTACATTGACGGTGACGCGATCGGCCTGCCTCGGAGAAAACAGAA
CTCGCTGAGCTCCACTCTCAAGCACGCCGACCGGAAACAGCGGTCTCATTACAACAACCATCACCACCACCGTTCCAAGACGCTTCCTGAGCAGAATTCC
GAGAGTGTGTAGCTGCTGGCGAAAACGAGACCAAGAGCTTGGAGCTTGGGGAACGTGGTCACCATGGAGAGAGAAAGAGAGAGAAGATGGAGGCAGGTAC
GTTGTCAAAAGGAGTATTCAAGCACGGATGCGTGACGGAGACCGAGCGTGTCATCATTAGGAAGAACATCAAGAGGAGCTTGCTCACTAGGAGGAAGCCC
CACGCAAGCGCAAGTGGAAGGCTGCTAATTAATACGGCCCCGACGACGGAGGGGGGCTAATTCGGAGGTTTTTCATTGGCGGAAAAACAAACTCAGGGGT
AACTGGAGGAGGACGGTTTTATTTTTGTGAGTGCGTGTCAAAACCCCCTCCCTCCCCCTCCTCAGCATCAAGATTGTTTTCAGCAGTAAAATAGAACCAC
ACTATGCATTTTGCCTCACACAGTTCTAAAACGAAGCGTATCAATTTTTACAGGTTCAGGTGTGGTATAGTAGGCTATTCGGGAGTTTGTACGGTCTGTT
TGATCCACTCGCTCGCGTTTGGTCTGGTGGGCGTGTTAGTGGAAGGAATCAAAGGCAATTAATTACTTAGCGAGAAAAGCGCAGGAGCGAACGCGCGCGT
ATCGCTCTCTTGGTGGCGCCAATCACGCTGCGTGGATAAAGGTACGTAGCTCTCATATACGCGCCTTCACGTGCTGCCTTTACATGCGTCTTACTGGTCG
CAGTTTGAGCTCATTACGCTAATCTACTGTGGCATCTTTCCCAGCTCTCCTTGACGCAGCGAGCTCCTCTCTCCCTCCTGCGATACTATCGCATTATTAG
TAGCACACAAGCGATTCAAGATCTTGGGACTTGTAGTGAGAACAGAAATGCGTGCGAGTGAGCACGTCGNNNNNNNNNNNNAGTCGCCTCTGCCGCCGTC
GGTCGCAGGTGATGACGATGATTGGGAGACCAAGGAGCCGACGGCTGTGCCTCTTGTANNNNNNNNNNGCCGCAGCGTCTAATGCGAACAGCAGCAGCAA
CACGAATGCAGCGACTGAGGCGTTTGGAAAGATGCGATTGACGCCGCCACCACCTGCTCAGGACGGCGGTGCTTATGAACGCACGCCGCAGTCGCAACCT
GGTCCATTTGATCCGAGCAGTGCGTATGCGCAGCCAGTGAGCGCTGCGACCGCGAGCGCAGCGTCTGCACTGAATGGTGGCGGCGCGCNNNNNNNNNNCG
CGAGCGACTGACAGTGCTCAAGTTCGAAGACCAGATCGTGCGCTTCATCCGGAGCTCGCGGGAGCCGCAGTTGATCTTCCCGCCGTTGTCCTCGTACCAC
CGGCTGATCATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNCTCGAGCACCAGACTGCAGACTACAACCCGTATGCGGTATGTGTCAACGTAGTAAGCTCTGAGTGCGAGTTGTGCGTGATCATTAAT
CTCTTTTGTGATTTTTGCTGTAAACATGTAGCAACATGGCGGCTACGATGGCAATTCGTCGCGTGTTGTCACACTGTTCAAGACCTCGCAGAGTGTCGTG
CCAAGCGTGTTGCTGATCGACTTGTCGGCGGATCGTCAGCAGCCCATGGTGACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCAGGATGCGAAGAACGCGCAGCGAACGATGCAGGACCGCG
AAAAGGCGTACGCCGAAGCCCGCGCGCGCATCTTTGGCGAAGACAACACCACGGCCACGGATGGCACTTCGTCGTCGTCATCCACGACTTCATTNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACCGAGAGCAAGAGCTGAACGATCCCGACTTCACACGC
AACCACGACGCGTATCGT