Description :
From Genome Similarity Track
Location :
Scaffold_3233:328- 2601
Sequence
2273 bases(100 bases per row)
GCAGGATCTTGGATAGCTGCCGACTGGAGCAGACGCTGGTGGCGCTCTATTTGGTGGTTGAGTGCGCCAGCCTTGTGCAGGGCCTGGAGATGCTTGAGGA
CGGAACTGGACCCGCGCGACGCGATCTTATGTTGAGCCAGGAAGGAGAGAGCTTCTTTCTCCGCGCGCAAACCGAGGGCAAGGACGTCGTCGCGGTAGCT
GACACCGCTTATATCCAGCCCAAATCCGTCGGCCAAGAACAGCTTCATGTACGCAACCAGCAGCTTCGCGTTCGAGCGCTGTCGCTTGGGCTCGCTCGCG
TGCCATCGTGGCTCATGGGCATACCAAGCAAACCAAGTGGCGTGAAGGTGAGTTGTCCCACTCCTGCGCTGCATCTTCTTTGGTGTGCTGACTTCTTGCT
CTCCCTCTTTTTCACTTGGCTTGTTGCGCTTAATGGTCAGGACAGGATCGTTGTTCAGCTTGGCCTCCAGAGCGTCCATCCGCTCGTCTTGCCGCTTCGA
CATGTTAATTAAGTGCTTAATCACAGAAGCTTGGTGATCGATGATCTTCTGCTCCTTCGTTTGCTGTGCTTGGTGGGTAGTGTCGTTTTCCGGAGTTTGC
TTGTTGCTACAGGGTTCGGCTGCTAGCGAGAGATGCGCAGACCAAGCAAGAAGATTCGCCAGCGTGCTTCCACCGCTTCGCACAGCACTTTCGACCCGCG
TGACGACTGGACTGCTGTGGCTCAGCTCCTTCAACAGCGGGAAGTATCGGAAGACGGCCGCAGTCAGGATGTCCACGACCTGCTCGTTGACGTTGAAGCT
GGAGGTTGCGAGGTTGCTGCAGGACGTGAACATCACGCCCTGTACGCGCTTGATCTGCTCAAGTGTCTGGGAGTCGAAGCTGCTGAGGTCCTGGAGTTTC
ACCTTCGTCTTCGGTTCGTATCCTGCGAGGACTTTGGCTACCTTGTGATCCTCCTTGCTCGTGTTGAAGATGTAGTTGAAACCCTTGGTCGTTGTGCTCA
TGTTCCAGGAACCTCGGTCGAAGATCCAGCGGTCCGTCAATCCCTCAGAGCCGTTCGCGTGTTGAGCTCCCCCGCGGCGAAACGAGTGCGAACTGAGTGC
CTTCGTGACGCCAGCAGCTGGGGCGATCCGCTCCAAGACGCGGTTGACGTGCGAGTACACCGTCGGCGTCGACGGCGTTCCTTTGGTGGCTGGGACAGAG
AGTGTCGATGGCGCGGCGGGGGCATTCAGGAGCTCGACGAGCGATACATCGTCGGAGATCGTGGCCGTTGTCAAGGTTTCTTGGCGGGGAAGGTTGCCGA
CCAAGTCATCCGAGGGCGCTCGCTGGACAATCAAGGCAAGAGCCAAGGCCAGCAACGGACAAGTGAGGAACTCCTCGTCCGGGAAAAGCGAGAGCCCCTG
CTCCTCGCTCGTCTTCACCCTGATCAGACGCAAGAAGAGTACGCCGCCCGCGTCGACGCTATCGTTCCGCTTCCGCAGCATCCACAAGTCCGACGCGCGA
CCGAAGAGGTACCAAAGAAGACAAAGCAGAGCAGCATCTTGGTAGTCAGTATCACAGGAAGCATTGGTATACAAATATACAAGCATTTGTTTTAAATCGG
ACTTCGTACATGGAGGTGCTTTGTTAACGAAACCACCACCCTCGCGCTTCAAACAGAAGCTGTCAAGCGTTTTCCCCATTTTAAGCAATCGGGTCTCTAA
AGACGCACGATGCTGGGGAAACTGGTCAAGCAGCCAAAGCTTGGCTTGCCGATAGTACTGCATGGCAGTATTTCTAGCTAAAGGTTTGCCCTTTTTGCCT
TTACTAAATGCAAGATGCATTCCAAACTTATCCATTACAGATACAAAACATCTTCCACTGACATCGCGCTCAATGCATTTTCTTACGTACTCCTCTACAA
CGCCCTCTGCCTTCAGAAATTTCTTGAAGGCAGATAACGCTGTAGCCTTGGCCCTCAAAGTGTTGCCAGGCTGGAGCTCGTCCAGGCCCATCGCTTCCGT
CCGATGCTGTGCAAATATGGGAGTGGTACGTGTCTGACCTACTATTTGCATTGGCATATACATATTTTGAGCTGCGATCGGACTCGATACGTCCGATCGA
ATGGCTTAGAGGACTCACCTAACCCTAGGCGAAAGTATTGGACAAAAATGTTGAGTGAAGCTTCGGCCATTAGTTGAAATGCGTAGAAATGATGTAATTG
GCCATTTATAGGTGCCCAGAGGTCATACAAAAATTAAGTATGGTCCGATAGCTAATCATATTCATCCATACCA