Description :
From Genome Similarity Track
Location :
Scaffold_3132:328- 1634
Sequence
1306 bases(100 bases per row)
AACTAAAGAAATATATACCTACTTATGTAATTGGAGTTGGGCCCATTACACCGGATCCCATACTTCCGAGTTCGGATCCAAGGAGGGAGGATCCCGCCTG
GAGGGACCTGGATCCAGGGTATAGGGATGATGGATACAGTGGATCTCGAACTTTCGTGGGACAATGGAGATCACAGACGGTTGCGAGATGATGTTGGATG
ATGGGAGAGCTCAGATCGACGACGAGTGCAAACTTACAGTGAAGTGGATCCAAGCGACCTGGATCCGGATGAGTGTACCCATAATAGGGTGACCATGATG
ATTACGTCATGGATCCGGCGGATCTGAAGATAACACAGCTGGGATGATGGGTCAAGGGAAGAAGGGACATGCAGCCGAGCCTGGTAAGGGATTAAGCAGA
TGAAAGACATAGAAGGTAGAAATCCAGGCAGGTATAGGCTTAAATATCAATACAGTCCTCAATTTGCACAGTATCACGTAAGTGCCTTCCTGCCCTCAAG
AACCGGAATTACATTGGCCGTACGAGCTCGGAGAAGGTTGGGAATTGCGAATCTAGTGTTGGTAGTGATAACTGGATAATACATTGGCCAGATCCTACAA
CCTAGTGAGCTTCCCTATACACGTGCAGATCCAACAGGTTAACCGAATTTACTACTTGGTCGATTACACCCTAGAGGTTCTCAACTCTCAAGATCCCGTC
ACAGGAGGCGGCAAGTACGACGCAAAGGAAACTACAAAGGCAAGGGAACACACCCGCAAGGCGACCCTACGGCCAGATCCACGATCTAGGCCCCGGATCC
ATAAGGTCGAGTATTCGCTTAGAATTCGGAACAATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCATCCCCACGTCTCGCCAAGACAC
TCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAAGTTCAGCAGAACACGGAT
CATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTTGGTGATCCCGCAACACCACAATGGTG
CGCGTGCCCGGAGCTTTTGGTGACTCGGGATTTCACTGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGGAAGAGGCGTCGTCGGAAGTCG
GATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGAGAGGTGGATCCGGATCCGGATCT
AGAAGA