Description :
From Genome Similarity Track
Location :
Scaffold_42:32796- 35333
Transcript NameFunction/comments
Phyke_g2237conserved hypothetical protein
Phyke_g2238hypothetical protein

Sequence
2537 bases(100 bases per row)
GACCGTTCACGTTTCTGAAATTTCGGAAACTCGGAGCGATTTTTGAAGTTCACCAACCCTagtcaagaccaagcagcaataTGGCCCGTGGAGCAGTCGG
CCGCCCGAAGAAGACCGATGGCGATCACACGCGCAAGCCTCGCAAGAAAAAAGACAAGAACGCCCCCAAGCGCGCGCTGTCTGCCTTCATGTTCTTCAGC
AACGACATCCGTGACACAGTGAAGCGCGAAATGCCggagctgcagttcctcGAGATCTCGAGTGAGATCGGCCGCCGGTGGAAGCAGATTACGGATGAGG
ACCGTCGAGTACGttgcctgctgctggaatcAAATGTGTACTGCCCTGGTGCCTGTGAACTAACATTAAACCGTGTCTTGTGTCTTTGTTGCAGCCCTAC
GACGAGCTGGCCGCTGCTGACAAGCGGAGATAccaggaggagaaggaggactACGTGCCCGACCCGTCCTTTGAGGTACTTTGCTGCCTATAGCATCTGT
TGTTACTGCATTCCCGGTGCTGACGTTGCTCTGTTATTCTGTTGCTCACTTCACAGCAGCCTGCCAAGGGTTCTCGCAAGAAAAAGGACCCGAACGCCCC
CAAGCGTGCCCTGTCCGcctacttcttcttctgcaacGATATCCGCCAGGAGGTGCGTGATGAAAACCCCAACAAGAAGATCACGGAGATTGCGACTCTG
CTGGCCGAGAAGTGGCGCGCGCTGCCCGACAAGAAGCGTGCCAAgtaccagaagcagcacgaggaagccaagatcaagtaccagcagcagatggacGAGT
ACAACTCCCGCggcgctgaagaggaaaatgaagaggagcacgacgaagaagaggaggacgtcTCGGACGACGAATAAATTGGCACCATTTCGTTCTCTGG
ACCAAGCTGCAAGCCAAGACTTGGAGTTTGAGTCGATAGTAGGCGGGGTGTCGCTCGCTGGTTCGCAGAGCGTCGGCGACAAGGCACTCGACTAGTTAGT
CAAGACGAGGAGTGAAGCAAGTCGTCTGCCGCTTTTCTTTTAGCTCGTAGCGCATGACATTTAATTCTTTTTAACGTTTTGAAATTTGCCTTCGTTCTGT
GGACGTTTAACACGCACGTGTTCAAGGTCGTAGTCCGCAACATCTGCGTTGAACTTCAATCGGGAACGGAACGGAACAGCGCACGCATCGTTACAAACTG
TATCGGGACATGCCCACCCACTGATCTACGCGCACTCAAGTCGCTTCGGCGGACCATTACACAGTTTGCCTTGATCAGACATTACACGGCCCGATGAAGC
TTCCTGGTCGGCGTTAAGGTATGAATGTATCGCACTTAGGGCACAGTTCTTCTACGATACATGTAATAGTCAAAAACGACGCAACGCTTGCAGTCAAATC
GGTCTGTTCGTGCCCTAGTAGATATCTATCTGCCTAACGGAGCAGGACATCAAAGTCCGGGGTCACCACGAGGTGGCGCTCCACATTGCCCAATATACTC
AGATTTTTATCGGAGGTGTTCACCACGTAGACCTCCTCACAAAATGACGGAGTTTGGGCCGTTGCTACCTCGAACTGCTTGTCACCGATCATCAATACTG
CCTTTCCTGACTTGTGCACACATATCTAAGAACAGTTCACGCCAGACTTACGTTAGCTCACAGCGCAATAGAGTATGGGTACGAGCTAGCTGATCGATCT
CACCTTGCCAATAAAACCGCCCGGAGCTGTCGAAATCGAGTGATCGAACACACCATCATCGCTGCAAGTCCACATAACACACTCATCAGCACATTAGACT
AATTGCCAGCACGTATACACACTTCGTCAACGGATCTTGCACATACGCTGactcctcctgctctttGCTCTCCTTCACTTTATTAGATGCCTTGTCGCTC
GACTCTTCTGCATTCTCCATCGACTCATCTCCGTCCGTATTTGTCGATGAGATGGTTGTCTTCGAAAGGGGGAGTGTCGTCGGCAGCTGAATGAAAAATA
GGGAGTCCTCGGGGATTGACACGTCACCAGACTCGTCGCAAAAGACAGCGCCCGCGCTCTCCGGTTCCGGCGGACGCACAATAGGCAGACTCATAGGCTC
CATGTCGGACTTCACAACAGGTGGCCATtgctcctccacctgcatATCGGGAAGCTTTCCTCCTGGCAtctcatcatcatccagaacACTAATTCCTgtg
ccaccagcagctgaaaaCTCGGCAGACAGAGAGCTGCGTGGGGCGGGACCACTGGACCCTCCGCTGTACGATGAACCACCCGATAGTGTTCCCACGAAAG
CAACCTTGCCACTAGGGAGAACGCCACGCCCCCGACCACGACTGCGGccacctcctcgtcctcctctgCCTCCACGACGTCCCAAGTCGCCTCTTGGACC
TCTGCTGTCGTGTTTGAGCGCTCCGGCGCCGCTCGAATGTGGCTTTGCGTCATATGACCGCTGTGGTGCACTtgcagcgccttctccacgtcctTCAGAT
GTAGGACGACGCTTAGCAACCTTCGGCACAAACTTCG