Description :
From Genome Similarity Track
Location :
Scaffold_12:327948- 336027
Transcript NameFunction/comments
Physo_130668hypothetical protein

Sequence
8079 bases(100 bases per row)
CGACAGGGATTACACAAGGTACCCACGCCAACCAAGGAGTGTGATTCTCAGGGTTTAAAGCTTTGCGGCTGCGAATCTCTGGGTCTATCTTCTTGCTGTT
GACTCTCAAGTCGATTCTCTGGGTCTACCCCTGGGGAACAGTCTTGGGCTGCGCTATACGAACCCCCCCCCCTGGGCGACAAAGGTTTCATCGGCCTCGC
CTCAAATGCTCACGAAGATGATGGCCTTCCTGGAGTCCAACTCAATGTTGAACGAGACTATGAGGATTTGGTTCTCAGCGGTCTGCTCGCTCAGCTTCTA
TGGAATGTGTCGTATCAACGAAGTTCTGCTCATGAAGAAAGGCGACATCCAGCTCGGACTGCAACGTTAATCCCGTGCAAACGGCACAGAGATCCGCTTC
GGCTGCATTACCATTCGTGGCCGAAAGACAGACCACGACCCACTCGCCAGTCGGACGTATTCGCTGCACCATCTGCCGAAAGAGGAACGCGCTGCCGAGG
CGTTGACGTACCTGGAGAGGTGGTTCGCATACGCGCGGACAAAACTACACCATTCATGGTGCGATAGTGACTGTGCTTTCCCATCGCTGACGAAGATCCC
ACGTGGCTGCAGTAAAAAACGAAAGCCCGGTGCGACCGCTTCTACCAAGACTACCTCCTTTGCAAACGTCTGTGTAAAATGGGGATCGCCGATGTCCGAC
ACCAATTTCACGCAGGTGCTGAACATCGTTGCTGAGGCGGCTGGGATCAGCCGGAATTTGCTCGGCGACGAAATCTGGTTCACATCGCACTGTTTCCGGC
GCGGGGGTGCCCAGTACAGGTTCATGTTTGCACCAGAGAAGCGCCGATGGTCGTTGAAGCTTGTAAAGTGGTGGGCGGGCTGGGCGCCCAGTGAGAAAGC
TGAGACAGTTACGAGGTATCTTTTGGACGATGTCCTCGATCGCGAAGAAAACCAACTTGGTGACTCGTTGGTGCCCGACGCGGTGTCATGCTCTTCCGCA
TCGCTTGAAAGTATCAGGGATATTGAGTACGGAAGCTCGCAGGCAGAGACAGACGATTGCGAGGAAATACAGGTAGTGCAATGAGCGATGGTTCTGCGGA
CGTTTCACTTCGCGCAGTTGATGAGCTGAAGACGTTGGTTCAAGGGTTGCGTGACATGGTCCAGAACATCGCCAGTAGCCAAAGCTTGGCGCAAGACACG
GTACATGGTCATGAGGAGCAGGCGACACCCGGTACAGCTTCCGATGAGCCGATAGACACGTTGAGCTTAGTCTCCGAGCTGCCTGACGCAAACTCGTGCC
GTGACTACGTCAACCAGTATTGGAAGGCCAACCCAGCGTGCCATCAGAACCGAGCATGCTTCCACATGAGCGGAAGGTACACCGCTCGCGGTTATCGCGG
ATGAAGATTATCGCTGAGTATATCCGAGACGAATTCAACGGCGATGAGAACCTGTTTGAAGAAGCATTCAAGAGGTGCGTGCACGGGGAGCTGACGGTGA
ACAAGATTCTAGCAGCTATTCGTAACCGATGGCGGTAGTAGTATAGGTCGTCCTCATTTGTACTGTCGTCCTCATTTGTACTATCGTCCTCATTTGTACT
ATCGTCCTCATTTATACTGTCGTCCTCAATTGTACTGTCGTCCTCAATTGTACTATTTGAACCAGTACACTTTCAACCATACGAAAATGTCATATCCAAT
TGTGTATTTGTTATGCACTTATGAATCTGATCCTCTTCAGCTTCCTAGTCATCGCCTGAGTGGTAATCATCGTCGGAGTCATCCAACTCGCTGTTGAAGT
CGCTTGGGTGGTACTCCTCTGAGCTGCTGGCAGTTCTTTCCACTGCGTCGGAAGCCGATTCCTCCGATTCGTATGACCCATCGTATTCGAATGCTTGGTC
TGGTTGGTGGTCGTCGCCTTCACTGTCGCTGTCGAATAGGTTAACAGGAAACGGGAACTTGCACTCAGGACAGAGGAGATCTCTGTGCCTAGTCAGGCCC
AAATACGTCCTGTTGTAGGATATCAGACATTCGTAGTCCAGTTTGTGGTCGCACTGCGACCCCTCCAGTACGATACCAGTGATGGCATTGTTGCAGACGA
AGCACGTTGGAGGGGCGGGAACATGCTTCACCACCACTACCTCATCCTCATCAACATCAATTTGCACCGCAGCGCGGCAGTTGGCGCATCTTGGGTCATG
CTGAAGACTTTTCAGCACGCAGTGTCGGTGGATAGGCTGGCGGCAACTTTCGCACACCCAGATGGCCTTCTCACCTTCACCCCCGTATCTTGGCCGCGAA
GGGGGCATATACATATCAGGCAATCAGTCACACCATCACGCGGCTGCACAGTGTTCGCCACAATGTCGTTACCACTGCACTCTTGCCCAACCGCAGCTGT
CGAGGTCGACAATTCCAATTCGACATCCAAAACTGGTGAGGCATTGGTTGCCAGCTCCTCGAACTCGAAATTGGCCCAGTCGAGTAGGCTCTCCATGGTC
TCGTCTTGGCCATCCACAGATGGAGAAGCGTTTACGCTGTCAGGGGGTGCAATAGCGTAATCACGACCTTCAACATCATCGTCGCTCTCTAGCAGCTGGT
CGAAATGCGCAGATTCGTCCGCTTGCACATCAGTTGAGACGTGATCCACACGGCGCGAATCTTGATTACGCCGCCGGCGGTGCCATGCGGCGTCCCGCTC
TCGCCGTGCATGCGCCACGCGGTCGAGATGCTCGACGAGCTCCGTGAGCGTTCGGCACCGTTTGGATGCCTGGTGCCGAGCAAAGTGGTGGCGGTTGCCC
TATATCCACTGCCAGTACTTCTGGCAGAGCTCGCGAGGCAAGCTTGGGAGACCTCGGCAACGCTTAAGCAGGTGGCGCTGCAGATTATCGGACCAAAGTC
GTACAGGCAGGGTTCGCAGTTGTAGCCATTCTAATATCGGAAAGATAAGATCAATTAAAAATTACGTCAATCAAATTGTGATGGAATAAATTTCATGGGA
CCAAACCTACGTTGTCGCACGTGCGCTGTGAGCTTGTCGCACGAGTAGAGCAGAGGGCTTCGCGGTAGTTTTGATAATGAGTGCCATAGTTGACAGTTGA
GCCGCAGGTGTCGGATGCCGCTGGTGCGATTGTATCCATTACAGGGCGAAAAATGACTTTACCCTTACCCTAAATCTGAATCTACAGGATACTGGGCACT
GTTCGTTGGGGAACAGGTTCTGATTCGGCGTCATCAAATATACCTAGCCCTACTCAAAATCGCACAGCTCCAACGAAGTCCTACTAAAATAACGCTAAAT
AACATTTTATTTCAGCCAATCATATGCGAGATCAGCCAAAAATAATATTGACCACTAAGCATCGAGGAATCCTGAATGGGAATTCCGGCTCTCAGTCGTA
GAAATTGGTCGGAAATGGAGGGCGGTGACGGTCCACCGAAGTGCAAGTGCCCTACGTTCCCTAAGCTCGTGTAGAAGTCGAACATGGCCAAGCACCGCAA
AGTGTGCGGGAAGAAGAAGCCTCCGAAGTCGCGCACGGCTATAAACCGCGATTCCTACGCGAAGAACAAGGACAAAATCCCCCAGAAGCTACAGGAAAAG
CGCGTGTACGACCAATTCCGCCACCTGGAAGGTGCATAATTGTTAGAATGATATCAATTATTGGTAAATCTAACATGCGGAATATGTTGTGGCTCGTAAG
CAGATTACTGAGCGCGAGGCTCAGGGCGTGGATGTTGAGGAAATGGAGAAAACAGCTTGAACGCCATTACCCAAAGCAAAGGACGCCGAGGATCTGCTCT
ATGGTGTCAGTTTGGATCCGGACCTATTTGCCCATTTCCTCGCGGAGCTGAAGGCACGTTGCAAGGCACAGCACGGCCGCGGTCCATCGATGGTTTCTCC
TAGAGAGCTCTACCGGGTGGCGATTTTCGTTCTTCACCCCGACAAGCTTCGCGGCCAAATCAGCAAATTTGGAGAGGAGACTGATAAGTTGATGAACTAC
TGGAGAACGACGGCTAAGGCTTTCACCGTGTTTGGGAATGGACTTACGGCGGACACCGAGATGAGGCTTCAAATCGAACTTGACGCAGTGACGGATGTTG
AGTATATGAACGAGCGGCGCCGCGTATCCAACGCACGTAAAGCAAAACCTCGTGCTGAGTACGACTATGAGACGTTGGTGACCAACTTCCGTGCCAATCG
CAAGAAGGTGGAGCGGTACTTGAGAGCGAAAGATCACCATCTTGCTGAATTGCATGCTGGAAAGGAGAAGGCCAAAGCCGCACACACAGCCCAAGTGACC
AAGTTGAAAGCAGGTATCGCGAAACTCGAGCGGGTTGGGCCATGTGCTACCTTCCAGGAGTACAAAGCGTCCTTCATCAAGGCCAAGCACGCAGCTAGTA
CGAGTGACAAGTAGTGGGGCGTGCTATAGAAGCCAGACATAAGACAGATGAACTCTACGAGTTTTTCATCTCTGTAGGCTGCTTAAATGTACCACACGTT
CATACCAAAACGTACGAGTTCATACCAAAAGGTTCGAGTTCATACCAAAGAGTACGAAGTGTTCATACTAAAGAGTACGAGTTCATACAACTATCTACGA
GTTCGTACTGGTTAGTACGTGATTAGAGTTATAGGTACGTAGAGTATTCCGGCAACTCTTTTGCGGGCACGCTGCGTTTGTGCGAAGCTTGCGGTCTTTC
CTGACAAATGTAGCCAGCTTCGAAATCGTAAACGTATGCTCAGTGGCCGATTCTTCCGCTCCGCTATAGTGCTGGGCGTAGTAGCTGCGAAATACAGGAA
GTACGGCCCTCTCCCAGCGCATTTTATCGGACTCGCCCGTCAGTTTAGCGAACACGGCGACATCATCACCGAGCAATTAGGCAGCGCTGAACCAGCTGCG
CGCTACACCAGCATTGATTCTCTCGGCTTGCGTCCATTCTGAAAGAGGCTTGAACAAGTGCACCGAGGTGTCCGGAAACCACCACATCAGGCATAGGTGA
CTCCAGTCTCTAGCCGCTGGAACCGCAGGACTGAGCGCTTGCCTATTCGAGGCGGCACCTGGAGGTATATCTTTGCGTGCAGTCGCTTGTGACAGACTGG
GCAAGGTCCCAGACGTAACCAAACCTTTCAGCTGGCTAATCTGAGATTTAGCCTCGAGCATTAGTGTCTCTAGTTGCCGAATGCCCTTGAAAACGGGCCC
TTCTTCGATGTTTCTGCTAGCCTCATAAGGAGCGCTTGGACAACCGTGCAGATAACTCTTGTCCGGTCCAAACAGTCTGCGAGTTCACTGTCCTCGGTTT
GAACAGTCAGATCCAGAAGGTAGCGCACCAGCGTCTCCGTCGATTCCGAAACACTCCAGCCGGCCCACCACTTGATCATCCGTAACGACCAGCGCCGTGC
TGGTTTTGCGTACATAAAGCGGTATTGAGCCCCTCCTCGGCGAAATGTGTGTGACGTGAACCAACTGTTGTACCAATGCTTCGCAACGTAACCCGGTGTC
GATTGTCCCTTTCGGTTCAGCGTACCCACGATGCAGTTGAGTAGCGTGATAAAACTCTGTTCTCCTATTTTCTTACCCCACCCAATGACCACTTTTTCGC
AGCCGGTGGTATCGTCGTCGCTTCTAAGAGCTTTCTTACGGAGACCAGTACGAGCAGGGAATACGTAGTCTTCATCGCTCCATACGTGGGCTTTCGTCTT
CGTAGCAAAGTCCACCCAATTGCAGAGGTGCTTTTAGGCATTGATCGGGGTTTATTCGTCCGCGAGATGGTGAAGATTATAGGATTGCCAGCGCAACCCC
AAAATAATCCCATGCAAAAATATTTCAGCCAATCAAAACCGAATATGCGAAAATATAATATCAGCCAGTAAGCACACGATAATTGGTCGCTGCACCAAAA
ACCGAAATGGCCAGGGCTCCGCACGGCAGCGCGGCGAAGAAGCTGTGCGAGAAGTGTGGCAATGGAATATCGCGCACGAATTCTCCAAGCACGCAGTGAA
ATGCAAGGGAATTAAAGTGCGCGACAACCGGCGCGAGATTCGGGAGCGCTCATGGGTCAAGCACCGCGCCAAGCGCGTAGGAGACCAGCGCAGCCGGCGC
GCGTCCGAGGCATTTCAACGACTTGAAGGTACCGTAAGGTTCTTTAGTTTGATATGGAGGACCCAAGCTTACCATTGTATACGAAGCGCTTCGGCAGCAG
CTCCGCGAGGTGGAGAGGGTGCCTCTCCCTCTTAAACCTGAGCCAGTGGGGCTAATTAAGCACCCCCTCGAGGAATTAAGCCGCAATGCGGATTTTGTTC
GAGTACATTTTCTCCCAAGTACGCAACAGAAATTGTCCATAGTGATGTATTGGTACTGACACGAGTTTATTTAGATGGAGACCGTCGGCTTGCTGTCAAA
GGCATGGTTTAACCCACCGGCGACCGCTCTTATCCCGATTTTGCAGGGATAAGATACATCTAGAAATTTGTATACTTGTGGGGTAGGGTAAGCAAGGCCC
CAGCGGCCGGCACCGACCCTTTGGGTTCCATTAGGTTTCAATCTCATTGGTCAGAGTTATCCAATCAAATGCCGGCTATGTGAGTAATACTGAGCTGGTT
CAAGACTCAACTGGAAAAAACCTTGGCCTATTTTTTCCTAAAATTCGAGATATCTCCATCTGTAGAGAATCCAAACCAGAATGTTGTGATACGTGAGCAG
AGTACTTAATATACTCACATTTGGTATCATCGTATTTTTTTCTGATCGGGATGACCCTGTGTGGCAGCGGCGGGGACAGTTCCTCGCGAGCTTGCGGACG
CTGAGGCAGCAAGCCTGCCTGTCGTGATAGTCTGTCAGCGTGGGAGAGATAATACCCAGAATCCTGGTCAATAAGCAATCCGTTCAGTATCTAGAGTGTT
ATTGTATCCTGCGGGTGAAGCCGTGGCCGTACAAGACCGTTCGAATATGAGGAAGACGTACTGCATGTGAGGAAGTCACTGAGTCCGTGATGCGGCTTGT
TATATGGTGTACATCGATTCACCTCTGTCATTCCTGCACAGCGCGTTGATTCATGCTTCCGCTGCTCGATGGCAGGCTACTGTAACTCTTGATGTTGCCA
GCACGATATCGTGCTCGCTTGGGTAGCTCCACGCCAAATGCAAGTTTGACGCCTTCCAAATTCGTAGCTCCAACGTAAGGAGATGGATGCGTTGGAGGCG
GGTAGACGAGCTAGAGAGCGCCACTTTCATGCTGAAGTGGACTTCAAAACATGCCGAACCGAAGGTAACACACTATCAAAAGCTTGGACTAGTTTACTAC
TCGGTCTCTCTGTTCCCTGCGAGACCTACGTGACGACAAGAACATCAATGGTGCTCCGGTGATATGGCTACTCTGCCGAATGAGCGTGAATCTGTGGATT
TCAGTGTGATATCACGAAGCAATGGTGATTGTTGCCACGTGGCTATGCGTATTGAATTTTGTATGGCCAACCACGACAACGTGGCTTCGCGGGCTCGTCA
ACACTGACATGTTTGTATAGTTCTTAGTATAGAGGTGTCATGGTTGATTCAGAGATCTCGACATTGACATGCTTATCTAGATTTTAGTATATCATATCGT
TATTGACTTTGATAAGTCAATATTGAGATTTTTTTTTACTAGGTTTCAGTATATCAAGCAAACGGTTTGATATATTGCTCCGTTAATCGAATATAAGCTA
AAACTAGCATAGACTCCGGTCGTTCGCCGATCTACGAGGCTCACTGGAAGCTACGACAGGCTGTCCATGTGGGGCGCGGGCATACTGTCAGTGTCGAAGT
TGTCGATCGCCACGAACGTCGTATCGGGATTGGCGGGGACTGCAAGTGTACTGTCCAAGTCGATGTAGTAGAGGATCGGCATGCAGCCCGAGTCGGGCTG
ATCGGTGGCCGCGTGCATGAGATCCGCTCCGGGCCGGACTGGTCCGTGAGGATGCAGTCCATTCCGGGCTTGATCAAAGCCGTGGACGGGCAGTCCGTAT
TGGGGGTGCTTTGGGTCTGCGGGCATGGGGTCCGTGTCGAGCAGATCGGGGACCGCGGGTCTGCCATCCGTGCCGTGAT