Description :
From Genome Similarity Track
Location :
scaffold_53:32786- 34025
Transcript NameFunction/comments
Plaha_PHALS_02326Predicted alpha/beta hydrolase
Plaha_PHALS_02327ESTERASE/LIPASE/THIOESTERASE DOMAIN-CONTAINING PROTEIN

Sequence
1239 bases(100 bases per row)
CGTGTATATACCACAGCTTATAATTGTGTTAGTGCACGGTAATAACGGCTCAGCCGCTGACTTTGATGCAGTCGAGTCCGCACTAGTGACCAAGTTTGGT
GAAGGCAAGATACTCATCATCAAGTCGGAAGCCAACGAACTAAACACGTCAGTAGGCGTTGAGGCTGGTGGTACAAGGCTTGCGAAGGAGGTGATTGAGA
CTGTATTAGGGCATGAGTTGTGCCCTGATGTAGAAAGCTACAAAATGTCCATTGTCGGGCACTCTTTAGGTGGACTCTACGCAAGATACGCGCTCGTTCA
AATTATGGACGCACTGAGATTTTTGCACGTTGAATACGTCGATTTTGTGACCATCTGCACACCTCATTTGGGCTCGAGGAGGGCGAAAGGGCCATCAACA
GTGAAGGTTGGTCATTAACTTTATTATTTTAACGACAAAATGCTCGACTGATGCAATATCAAAAACAGAATATTCTTCGTCTCGGTGTACACAAAATGTT
AGCGTCATCATTATACGGACAAACGGGCATGGATTTATTGCTAGATGGTAAGTTGTCGCAATTTATTCGAGGATTGCGGCAGATTTTTGATTGCTTATTG
ACTCTTTCATAGTACAAGAACAAGTGAAAGAGAAAGAAATAGATGCGGCTGCAGTGGGGTTGCCTCGTTCCGTGCTAGAACTCATGAGCGATCCTAACTC
AGAGTATCTTCACTCACTTAAGCGCTTTCGTCATGGAACATTAATAGCGATGACTGACGGCGACGTTGTTGTTCCATATCCTTCAGCTGCTATGCGCAGC
TACAATCCTTATATCAGTAGTTTTTTGACGGAGCATTTCACCGAGTGGCGATGGCATATCCACCACTTTGGCTTCACCGCGGGCAATGGAAGTGATCATG
CAATTAATGCAGAATTTATTGAGCGCCTCAATTCAAAGATCGACACCTCGATTGTAATTAATGAGCACGAACTGGGACTTGATGCGAGATGTGCGCCACG
TATTTCAAGTATCGGTCGATTTGACTGCGACAACAAACAAGAGGTTGAGTTTCCGCACGAGATGTTGTGCCATTTGCAGCAGGTACTTCCATGGCGACGC
ATTGACGTGACCGTGGAGCCTTGCGGCGTGAAAGGAAAATTGCGACTGCATGACTGGCCTATTAATAAAATGCaaccttcagattgtcgagCAAATGAGT
TTATTGATCTTTTGTGCGATATGATCGGAGCGGACCATG