Description :
From Genome Similarity Track
Location :
Scaffold_652:3278- 4864
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_652-fgenesh-gene-0.2Cryptochrome

Sequence
1586 bases(100 bases per row)
GTTTGCATGCGCGCGACCGACGCCTTCGACGCACCGCCGTGACGCGGTCGTGTGGTCCACGATCGGGAACGGGTAGTCCTTACCAATGAGACACCCGGCC
GTGCGCTGCACGCTCAGCGGCGCTTTCCAGGGCTCGAAGATGTACCGCGCCGGCATTTTCCGCAACGCCGGGATGTACTTGCGAATGAACTTGCCCTGCG
GATCCCACTGCTGAATGAACATCGACGGCGAGTGCACGGCGTTGTAATCCGAGAAGAAGCAGCTCGAGCTCACCCAGAGCCAGTTGCCGATGTTGAGCGG
CCAGTCCAGGTCGATGAGCTTCTCCTGGAAGAAGTACGCGCCGCGCAGCCACGATATGTACAGATCCCCGCGTGTGAGGAAGCACGCGACCGCGTGCCTC
GCGACGTGGTGCGCCCAACCCTCCTGCTCGATCTGGCGCATCACCGCGTCGATCCACGGGTACCCGGTGCGGCCGGTCATCCAGCTCTGCAGCTGCTCCA
TCGCGGCTTTCGTGTCTTCGCTCCATACCGAGTCTGGTGGCGGCACCTGCTGCAGCTTCCAGTTGATCTTCTTGCACAGCGGGTTAAACTCCTGGGTGTC
GAAGTTCGTCACGCCCACGCAGTAGCAGTAGAAGAACTCGCGCCACATCAGCTGCCCGTCGAGCGTCACTGGTGCGGGACCTTTCAAACCGGGAAACTTG
AGCTGAATAAACATGATGCGGTAGAAAAACTCACGCAGACTCACACATCCAAACGCAACGTAGGCGCTCAACGCTGTCGTGGACGGCTTCTCGAGACACA
CGGGTGACGTCTTTGGTTTCTGGAACAGCCCCACGCGCTCCTCGTTTGCGCAGAACTCGTCCAGCGTCTTGAGTCCGACCGTCTCGCCACCGTACATAAA
CGGGTGGACCTCCGGTGCGCTGTGGCCGAATGCCTCGAGACTCGGGATCACAAACGGTTCGTCCCTCGGCCCCGCGATCACCGCGCCGCTGAATGACAGA
TACGTGCGGCAGTAGGTGTCCAACATCACGTACAGCTGGTCCTTCGAGAGCGTCCACCCAGGTACGAACCCCGGGCTCGAAGTTGGCAGACTAGGCTGCG
GGAGCTCTTCGACGATCTTGAGGAACTGCGCAAAGTCCGTCAGCGGCTCGCCTCCGTTCATTTTGATGACAGCACGGGGGTCAAACAGCGTCTGGCCGTG
GAAAGTCGCCACGTTCACACTGAAGTGGTGCGCGATCGCGCGCACGTCGTTATCCTGCTTGATGCCAAACGGCATGACAAACTCCTCGAAGAACAGGTCC
GTGACGCCCCACGCCGGGAAGATTACCTTGAACACCTCGGACGCCTCGCCGCGGAGTACCGCGAGCCCCGAGTGGCGCGCTTCCAGGCTCTGCGACAGGT
CGAGCACGCACTCGAGCAGGAACTGGAACCGCACGGCGCCGCAGCGCTTCTTCACCGGCCGGTGGATGATGTAGATTGGGATGATCTCGGCGATGCCCAG
GTCGCTTATCGCGCCTTGCAGTGCCGAGTTGTCGTGCAGTCGCAGGTCCCGCCGGAACCACACGAGCGCCCGTCGACGAGGTAGCG