Description :
From Genome Similarity Track
Location :
Scaffold_1612:3278- 4448
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1612-snap-gene-0.4HECT ubiquitin ligase

Sequence
1170 bases(100 bases per row)
TTAATCCGTGGTGAAGCCCTCGATGTCCGTGTCCAGCGTCGCGTACAACATCGTCTTGAGCTGCTCGCGACTCTCGTAGTACGGTAAGTCCAGCTGGTTG
AAGCACGCGTGGCCCCAGATGTACTCGTTCTCCGCCAGCGACACGCCCTTCATCGTGAACCGGTACAGGCGGCCATCGATGCTCGTGAGACCGCTGAAGC
CCTCGATGGGGACGCGCGACGATCCCGTGGCGAAGTGCAGCAGTCGCCGGCGGTACTCGTTGGGCATCTCTCTCACGATCTCCCAGAACCACACCACCAG
TTCGTGGCCGGCATGCAGCTTCCCGCCGCTGTAGTACGTGTTCTTTTGCCAGTCGCTCACATCGATCTCGTCCGAGCCGCAGAGCACGTAGTCGAACTCC
TCCGGGTCGAAGAGCACGAGCAGCNNNNNNNNNNCGACCTCGTACACGCCCGTTAGAAAGACAAAGAGCTGGCTGGACACGCTCTCGTACAGCAGATACT
CGAACCGCCGCTGTAGATACTGCTCCTTGTTGGCGTCCGTGACCTGGACGTTGCGGCCGTCGTCCACCAGGTCCACCTCGACCATCTCCGCGCCTCGCTG
CTCCGTGACGCTGAACGTGAGGTCAAGCACGTCCACGCTGTCGTTCGACAGGAGCCACAGCATACTCTGGTACGCCTGTGGGTCAAAGTACTCGAGGTCG
TTGAACGACACGGGCACGCCCAGGATGAGCTTGAGCAGCGGCAGCGCCAGGTGGAAGCCCAGCACGTGGCCGCTGAGCAGCGCGCGTCCCACTTGGCGCC
CCGTGGCGAAGAAGTACACGAGGTGGTCGGCGCCAATGTCGTGAGCTGAGTTGGAGTTGAGGTAGAAGATCTGTTCCTGGACGTCCACGCATCGGAAGAT
GCCCATGGCTGCGTCCACCAGTCGCTGGTTCAAAAGAACCGACCACTCGCGGTAGATGCCACCGGCGTCCACGCCGCGCTCGTCGACAAAGTTGATGCGA
AAGCTCGAGCGGACGTGCTCGCGTGGGACGGTACTGAGGGCCTCGACCGAGTCTGCCAGCAAGCTCTCGCGGCGGATGTTGAGTGTCACAAGCTCTTTGG
ATGCGGGGACCATGAGGCCGACAGTTGTGACGACAAAGTGCGCAAACTTGGTCGGAAAGTCTTCTGCGGC