Description :
From Genome Similarity Track
Location :
Scaffold_19:327794- 329205
Sequence
1411 bases(100 bases per row)
GATCGGCTCCGTAGGTTAGTCTCTTCGATACCTGATCGCTGCAGTAATGTTGCAGAGAAGCGAGGAGGAAAGACAAAGTGCTAGGACCATTTAGTTGCCT
CTAGAACATTTCAGAAAGTTAAATAACACGGGGTCTTTACAAATACTTTATACTTATGACCAGGCCATTTTGGACACCCATTCCGGCTCGACCACTAAAC
GAAATTTGATGCAGAAAAAAATGGTACCCTCCTGTAAAACACAATTAAAGAAGTGTTTTGTCCGATTTTCAGCTCAAATGCACACTAATTGGCTGAGAAA
TTTATCAAAATAGCGATTTGTTATACTTATGGCCAGCACTGTAAAGTGCGCGCCATAATCTCAAGGACACCATTTTTTTTCTTGAGATGTTGGATTTTTT
TGAGAATTTTTACTCTACAAAGTTGATTTTTTGTCATGTTGTTGGGCACCATATGGACAATCTTGTGTGTTAATTTTAGCTCCATTGGACTTCTTAAAGT
CCACAAGAAAAATATTATAAATTTAAAAAAATCGACATAAACATAAGGGCAGATGAAAACAGAGCAGTTTGGGGGCGTTTACGACTGGATTATTGTGTTT
AATGGTTTGACAACATGTATTAGCGCTTGTACAAATGTATAACATTGTTAATTTTGCCACGGAGGCGTGACAATAATGCCGAAGTCTCCAGGATTGACCA
AGCTCGAACAAGGCAAGATTTTGGCGTATTCGAGCGCAAATATGTCAATTCGGGACATTGCAAAAGCTGTTGGACACTCGAAGAGCGTTGTACATGCCTT
CCTGAAGAATCTCAAGGGCTATGGAACCAAAAAAAGCCCCGAACGACCACGTCTGTTGAAGATTCACGACCGCACCCGATTGAGAAGATATGCAGCAACT
GGTAATTACACGCAAACCAGCTTTACCAGAAGCTAAATATCAATGCAAGCATCCGCACGGTGCAACGCGAGCTTCAACGGTGTGACTATCTTGGTTTCCC
TCGAGAAAAGCTAGTCGGGTATTTCCAAGCGATGACACCCCGCCCTACCCCATAACGGATCCACCACCGGAATGACGGCTCCGCGTAATCTTTTATCGTT
TCTTAAGTCGTGCCAGTAGTACTTGCAACCATCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNN