Description :
From Genome Similarity Track
Location :
Scaffold_5:32779- 34876
Transcript NameFunction/comments
Phypl_g223conserved hypothetical protein
Phypl_g224hypothetical protein

Sequence
2097 bases(100 bases per row)
ATGTCGATCCACATGCGCTCGCAGCTGTGTATGTGTCCCGCAACTGGccgtcagcaccttgtcCCTCTCTAATTGCTTTGCCTTCGCAGTCCTCATCCGC
CCGCAGTCCCTCAAGCTCGGGACGCGcgccgccatgtcgacgggcaagaagctgccgagccGCAGTCGGGCGatggcgctgcggctgccgacgcgcgcgc
tgcctCGCACGCCGCAGATCGTCGTGGCGGGCGCCGTGCTCAGCGCGtcggtgtcgctgctgctcaaggactCGGCGCTGTGCCAGGGCGCGATGCTGCT
CGCAGCTGCGGTGCGTTGTCTCGGAACGTGCTGAAAGTGCGCCATTTGATCTAACCGCTGCAATCTTTGCGATACAGGAGGGACCGTCGGGCAGCGGcga
ccccaagaagaagaacgaccccgtggagcagatcatcgacgtggtgctggccaactgCGGCGAGCTCACGCTGGCGAGCGGCCTGGGCTTCTGCTCGGGC
TACGCGCTCAAGCAGGTGGGCAAGGCTGCGGCGTGTGCGGTGGGCATTGTCTTCATCATGGCGCAGACAGCCGCCTACAACGGCTACATCGACATCAAAT
GGGGCAAGGTGCAAAAGGACATGATCGCCAAGGTCGACCCCAACGGAGATGGCAAGATCAACAGCGAGGACGTCAAGCTCTGGTACCGGAAACTGCTCAG
GATCATGAAGACCAATCTGCCTTCGTCCGcgggcttctccagcggctTCGCGCTCGGTATCTACTATTCGTAGGTGCCGTCGTGTGAGTCAGTGAGAGCT
TCCCGTCGAGcactcgtcttcttcatctgtATCATCCTTTTCTGAGCAACATGGTGGTGGACCATTCGTGACAAAAAATAAACATCACATTGCTACAGAA
TGCTTGAGCCTCCCGCCCTATTCAGTTGGGAAGGCCTTTGCTAGAAACCCGACGATGATGGAGCGGTCGTCTGCGCTGGTTACGCCCATActcttgagct
cgcgcgaGAACGCTGGTACACTGCTGATTCCGTTGCTGATAAGGTTGAGTCCCAGTGTGGCGTACAGGATGATCTCTGGCCGCGTGAACGATAAAAAAGT
ATGTTTGGCGCTCTCGGAGCACGTCGGGAAGCAGTCCTGCCACATCTTTTCGCGTAACCGCGACTTCATGTCGTTAtccgccacctgcagcgaaTGCGCG
AACACAAGCTATTAGACACTTGCAAACCAATagcatcttcgtcgtcaagACCGTACCGATACAGGAATGGATGCGGGCATCTCGGCTCCATCTTGCTCTG
TCTGCAATAATATTCCACGACAACCACATCGAACGCATCAGCAACCGGTAGCACACCACACGCACATGGCTTGCCGAGAAGGGGTGCGTGGGCCCTACCG
ACAAGCCAACCTTACGGAGCTCGCGGGCACGGAGGTGGAACCCCCGTGCGGTCAACTGCGTCGCCTACAGCAAGGACAGCACCAGCCAACCAACGACCAC
ATCGCTAGAGTGGGTATCGTCCCGTACGTTTTCTCCAtgcccaagcagcaagaGATCATCCACCACTCTACAGGGCAACTACACCATGCAGGTCGTACCG
TCGGGTCCTTCTCAATGTAAATCCGGTACGCCTCGTTCGTCCGCAGCCGTGGCGTGTACAGTTTGGTCTTCCACTCCTGCCAACGAAGTGACAATGCACT
GATTAATCCAACTGAATCAAATCGAAGCAGTCGATCCGCAGGTACCCAcctccgtctcgtcctcttcgtaGTCGAACTCGATGGGCGCGATCCAGCCTCG
CTCCAATAGTCTCGCCAGGATGTGGCCCGCCATCCTCGTTCTCGCCTCGCCcaccagcgtcgtggcggtggccgtggtcgtgggcgccgtcgacgcgctg
ccgtccacgacgaggtcggcgtcgctctgctcgcgcttggccgtcgtcatctgcgtggtgaagagctgcacgccgtcgcGCTCCAGCCACTCGCGCAGCA
CCGTCTCCTCCATGAACTCCatgtcgttctcgtccgACGTCTCCAGGATCCCGgcgtgctccagcagcaccacaaactcgtcctcgctcatcTTGCC