Description :
From Genome Similarity Track
Location :
Scaffold_199:32778- 35502
Sequence
2724 bases(100 bases per row)
GATATACCCTCTGTTCTACCTCCAGATAGAGGTGTCCGTCATGAAATTGACTTAGTTCCGGGAACGAAATACAGTGTCACACTGTCGTGTGACACTGTAT
TTCCCTTTCCTAAGGAGCAATGTGAGGTCATTGATGACTTCTTCCGTGCTAAGCACAAAGCAAAAATGGTACGTGAGAGTAAATCACCACATTCGATACC
GACATTTTCTGTCTAAAAGCCGAACGGCAAGAGGCGTATTGTGCATGCTTATAACAAGCTTAATGCGGCTACTATTCCGGCATAGACACCCATTCCGTGA
AAGGATTTTCTTCAAAACAACATGGTTGGTTGTACTATGTATAGCGCACTCGACTTGGTTGATGGATACTATCAATTGGTCATGCGAGGCGAGTGATATT
CCGCTTACAGCAGTTAGCACCCTGGGTGGTATGCTATGGGAATGGCTGGTGATGCCCCAAGGGCTGTCTAATGCTCCATTTAATCGTCTGGTGACGCAAC
TTTTCCGCCCACACCGGGATTACACACAGACGTACTTTGATGACCTTTTTTTCCACAGTCGTGCCGAAAACGGTCGGTCAGATGTTGAAAATCACATTAA
TCATTTGCGAGCTGTGCTCGAGCACTAATAAAGTGTACGCCAACGCGTCTAAATGCATTTTTGGTGCAGAAAGAGATTTTTTTTCTTGGATGTTTTATTG
GTAAGCGCGGCATCAGAGCGGATCCCGCTAAGGTCAAGGCTATAGTGGACTGGCCGATTCCTAAGAATCAAAAGACTTGCGTAAGTGACTTGGCCTTGCC
AATTACTTACACAAATACAGCTAAAATTACGCTGGTATGGCTCGGCCATTAACCGATCTCCTTAAGGTCACAGATTGGCACTGGGGCAAGAGTTCCATGA
TAACACATTTCGGGCAATAAAGAAGAGTCCCCTCAATGCTCCTATTTTGGCGTTGCCAAATCCGGAGTACTCTTTTAGAGTTGTCTGCAATGCATCCGAC
TTCGCCATCGTCAGCGCCCTGTTACAAACAGATGCTGTAGGCCTTGAGCTAGTGATCGCATGTAAATCTCGTCAGCTGAAGCTGGTGAAAAGAAATATCT
AGTTCATGACAAAGCGATACTTGCTATGGAGTATGCAATCGTCATATTTAGAGTTCATCTGCTTGGCTCTAAGCCATTCGTCGTTTACACCGCTCATGTG
TCATTACGCACGGCGACACAGTCGCCTCGCCTCTCTCAGAGAATGGCTCGTTGGCTTCTTTTCGTTGCGGAATATAACTTTGAGGTGAAGTATAAGCCAG
GCAAACAAAACGTGTTGGCAGATGCCCTCTCTCGCAGACCTGATTATGAGCTTGCTCATGTAACGACTTTGTCGTCTTCTTTTGAGGAGTTAATTCGTGT
GGCCTATCCACGGGATCCTCAATGTGTAGCATTGTTTCATGCCCTTGGGAGTTAGAATTACAAGGACTCGGACAGTCAATTATCGGCACGCTTGCGGGCA
GGCCTACATCGATATTCCATCGATAATCGACTTTTGCGCTATCGCACATATGTAATGGGTACCGCTCGCATTGTTGTGCCTCACAATGAGGATTTTATGT
GTCGAATCCTCTTTGAGGCCCAAAATACTACCCTCAGTGGGCATTAGGGCCGGGAAAAGACTTATGGCTCTGTGATTCAACACTACTGGTGGCCCAAACT
CTACAAATGGGTGAGCACATACGTACATGCGAAACGTGCCAGCGGGTAAAACCCTCGGCACATTCAGCTGCGCCACTCGCCAGTTTACCTGTACCCACGG
GGTGTTGGGAGTCCATCTGTATGGATTTTTGTTTAGTCTTCCCAAAGACAGTAAAGGCAATACGGGAATTGTGGTCTTTGTTGACCGCTTAAGCAAGATA
GCTCACTTAGCGGCAGTGCCGGATTCCATCGATGGCAAAGGTACAGCTATGCTTTCTATCGATCGTGTGTTTCGTCAACACGGGTTGCCACTGGCAGTCA
TCTCTGATCGCGACCCTCGCTTTACTGGCAAGTTTTGGACTTACTTCTTCAAGGTTCTTGGCACGCGATTGGACATGTCCACAGCGGATCATCCACAGAC
CGTATAGTCAGACTGAGCGAGTTAATCGCGTCATTGGAAACCTTCTTCGCAGTGTTTGTGCTGAGTCGCCTAAGACTTGGAGCTCGATACTCTCTGTCAA
CGAGTTTGCGTTGAACAACGCTGTTCATGTCTTGACTGGCTTTACTCCCTTCTATGTGAATAGCCTCACGCACCCCCGCGTTCCGCTCAAGTTACTACTA
CGTGGTTCTAGGCTTGGTGGGGAAGTTTCTGCTGACAAGCTTGCTAAAATCAGCTCTACCACGATGCAGAAACAAGTAAACGATTTTTTCGCGACGCGCT
TTAGTGTCTTACGACATGTGCGTGATGCAATGGCTGATAGCCAAGACAAACAAAAGGAAAAAGCTGATATAAAGGCAGAGGATGTATTGATTCTTATGAA
GTTGGAGACCAAGTCTAATTAAACGCTAAAAACCTACCTATAAATGTAGTGTCTGCCGTAATTGCGTCCGTGATTCATTGGGCCGTGTACGGTCATAGCG
AAGAAAGACCTTGCCTATACACTCAATCTCCCGGGCAAGTTGCGCACACACCCAGTGTTTTAAGTTGGCTTGCTTAAGCCATATCATGATCCTTCTCTCG
TGGACCGGAAGGCGCTTGCGCCTG