Description :
From Genome Similarity Track
Location :
Scaffold_80:32778- 35017
Sequence
2239 bases(100 bases per row)
GGCGTAAGCTGAATCGTGTTGGAGCTTGAACACGGTCACTGTAGAAGCGAGTGAGCCATTCCCCTCCATTCGCGACGCCGTGAAAATACTGTCGGACGCC
ATACGCTGCTCCACAACAATTGTATCTGTGTCTGCGATCGGAGGGTCGACTCGAAAACGAATCGCTCCGCCTTTAACATCAACAGCGACGATAGATCTTG
GGGCGTCCAGTGCTTCAGTTTTCGTGGGGGATGCTGAGAAGATGATTTCCATAGGAGCACCCGAACCGACTGCATTCCCTGCTCGAACGGCGATCCTCGC
TGATGTCAAAGCGACCTCCAGCTCAAATGCAGCCGACAATGTTGCATTGTTCGTTTCCGCAACGAGAAAGCCGTTCATGAAGACTTGATACCCGGTAATA
GCCGAGCCTCCATTGTCAAACGCCGCACTCCACTGGACTTCAACGTACTTCCCCCAGTTCTCGACCACGGTGAGGCCAGAGACGGGACCTGGAACAGTCG
GGCTAGTGGTGCTTGCCATCAATCGCTGATGAACAACATACTCTTCCCCAGCGGGAGTCATCATCGCCAGCGCAAACTCGTACGAGGTGGCCGGCGCTAA
GCCACCGATAGGAAGTCTACCCTGGGTGTAAGCACTAACCAAGCGCGTAGATGTCGTCGACCCGCAAGCTAGTTTGGCGTCACGCACGCAAAGCTTGTCG
CACAAGCAGGTCGACACTCGCAACAAGTTGTCTGGAAATTGGCGGCAATAACAGGATCCCAGACTGTCGACACCGAAGAGCTGCACCGGCAGCGAGCGTG
TGGCCTCGACACCATCGACAATAAAATCGTGTCTGTAAGGGCTCGAGTCCACACCTGACACGCGTCCGCTTGAAAGTGAATCAAAACGAAGCTGAGCAAG
AAGGCTCTCATCCACGACAGAGCTCTGAAACCGCAGCGACTGGATCTCGGTGACAACAAGCGGTTTCCTCCAGATTCGAACCTGAGAGCATTATCGTGAG
CCACCCCAACATCCACTGTGTGTCCAGATGGACTTACATTGTCCATCGCCCCTTCGAAATGGCTGAAAACGCGCCTGGAGGAGACTTGCAGTGAATCTAA
GGAAATATTAGATTAATGTTTACTGTTAATATTCGCCAATTTAGAAAGCTCACCTGTGCCGAGCTGGAAATTCGAGGTCGTCAAGCTGCAGTTCACCATA
CTTAGTGTTCCAGATGCGGCTGGCAGACCATCTAGGAAGAGGTTGCTCGAACCATCAGCATTGAAGGCGACTGCGACATGCATCCACTGCCCAGTAGCTA
GGAAATGTGGGATATCGAGGAATGAGTCGCAACGTCCGACGCGCAGACCAGTGGTCGTCTGAGACATCCACAGTGCCGGTTTGGCGTCACCGTACAGAAA
CAACAGGCGTTCCGGCTCCCCACCACCCATCGGACTCTCGTCCCGAACCCAGAACTCCACTGTGAGTCCAGTTGAAGGCATCGCAAACGGTCTCGCACTT
CGAACGACTGAAGCTTGTGTGATGCGAACTTGGGCTTCTGCTGCAGAGCATGCAGCGTAGCATGTGTTCGGAGTGCTCGCAACGGTGCCAACCGATTGAT
ACATCCCATTTAACGTGACGCAGCCTTCGTACACAATTCCCGAACCTTTGCAATTGGAGTGGACAAAATCAGAAAATCAATCTCGCAACTCGTGTGATTC
CCAACACATGTTTGGACGTACCTGAGTAGACGAGTCGGCTCTCATTCAAGTTGGCTGGTCGACTGTAGACACGGAAAAATGATGCGTTCAACATCGGCGA
TGTTACTGCGGTGCCGAGTAGTACTTGGCCTCCAGTGGCTAATAGGGGGCTCAACCGGACTTGATCCTGGGCAGATTGGGCATTTTCAACGACAACATTG
TCCAGCGAGATAGCATCCCCCGCGACCGGGAATCCGCTGAATAGTACTGCTACCGATGCGCCATAATCGCTGGCGATGCCGAGGCTGACAGGATTCCAGT
CACCGACAATGGTGTTTGTCGACTCCCATCCCGTTGTCGTGGTGCTGTCATTGAAGACAAAGTCTACCCTTAGGAGAGATAATGCTGTGTGCCGTACAGA
CGTTAGTACCATGCGATTGTCCCACCCAAGATAATACTGGCATTCATACCTGAGCCCGTGCGATACTTGAAAGACAATGATCCTTCACCCCAAAGCTGGA
TTGGTAAGCTGCGGTACACGGCAACCCGCGGGGAGGGGG