Description :
From Genome Similarity Track
Location :
Scaffold_17:327776- 337193
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007080Similar to MUC1: Mucin-like protein 1 (Saccharomyces cerevisiae)
Pytul_DAOMBR144PYU1_G007079Similar to MVP1: Sorting nexin MVP1 (Candida albicans)
Pytul_DAOMBR144PYU1_G007078Similar to SPCC1450.02: Bromodomain-containing protein C1450.02 (Schizosaccharomyces pombe)

Sequence
9417 bases(100 bases per row)
ACCCGTTCCACTTGCTTCTCCCCGTGGACGCAGTCCCTGAAGTGCCGGAAGCCATCGACTGCATCTACGACGATTCGGCTGCGGAAATGCAGAAAAACAT
CATGAAAGTGGTCAAGAAACTGCTGGGCAGGGACAAGGCCAAGTTGGAGGACTTCAAGATCAATTCGCGCTTGTTTGGCAACAATTTCATGGAAGCGTAC
GAGTACCTGGACTCACTTGTGAAGGAGTTCAGCGGAGTGCGAGCGCTACAACTCGTGCCGTGTCTGTTGATGATTCAAGACGATTTCATGAAACGAAGTG
CGCTGCTGTTGGCTGCGAGAAACTACCGCATGCGAAACATGGCGACACTCGAGACACAATGTCAGCAATCTCGTGCGGCTGCAGCTATCCCCTCGCCAGC
TCCAAGTTCGACACCTGCTCCGGCTCACGTGGCGGAGCCTGTGGTCCCCCCTTCACCCGAGATCAAGCAGGAACATGTACCAATTCCTTTGGCTACTGCG
GTGGATAAGCAAGAAACGGGTAGTAAAGCGCACTCTGGTGCTGAAGAACGTTCAAATGCGACGACTGGAGCGCTTTACAAGCCAACAGAAGGAGTTGCTG
TCAGCGCCATTGCTCCTCAGAAGCAAGAAAAATCCCCTCTTCACATTGCTGCTGCTGCTGATACCGTCCAAGTCAACGTGCTCGTTCATTCTTCTGGTGA
ACCACAGAATGAAATCGATACTTCTATTACAGCTCCAGTTCCACATGTCGAAGGCAGCGCCCCAGATACAGAGATTACCGAGGTTGTCGTCGATTCTGAA
GCCGTATCAGCAGAACGCGATGACGAGGTCCAGACATCATCTGCAGTGAACACTGTGACTTCTGCTGCCTCGCCGGCGCTCGCAGTGAACCTTCAAGTAT
CTACATTAAATGTTGCTGAAGAAACCGTCACCGAAGTGTTCTCTCCTGTGGCTGTGAGCGAAGCTAGCGCAAGCGTTGTTGCTGACGCGCCTATGCTGGC
TACTGCTGCAGCACTTTCTGTCACCGAGAAACCTGTCGAGTCTGTTTCTCACGTCATTTCCGTTCAATCAAACCCAAGTAGCGCTGTCAGCTCTGCGACT
TCAACCGTGCCAATCGAGTCCGGTAGCGCTCATGAAATGTCAAGCAGCAACAGCTTCGCGGAAGCCGAAAGCCTCTTTGGTGAACGATTCTCGAGCAGCA
GCATGTCGGACTCGGCTGAGAACCTGTTTGGCGAAAGCTTTTCGAGTTCGTCAGCGCCGGTCGCGAACTCAAGTGGCTCGGGATCTGCGTCACCGCCTGC
TGTAGCGACGGTTTTTGACCCGAAGCCTGTGCATTCGCAGTTTTTGTTTGGCTTTGCCAGCGCTGGCGCAGATTCGGACTCGGACTCGGACGACTCGGGC
TTTGAGTCTTCCTAGGTCCCATGTTATCTGTGAATAATTTACCACCATGAGAAGAGAAAAAAGGGAAATCATTGAGAGATGTTCATTCTTGAAGCCATTT
ACCCAGGTTTCCGCACGCAACGTATAAAAATAGCTGTTGAAGTTGTATACGTTTACGTCGTATTGTTCTATATGTTGGTTGCAACCCATTAATTCTGGGA
GACCAAACTGTATACTTGCACCTTCTCATGCTTTATGCCGAAATTCATAAAGGAGAAGAAAGATGGCGCGACGAACGGGGCCGGTGACGGCGCCGCTGCA
GGGAAGCTTCCGCGTGGAGATGCTCGGCAGCCAGGAGTCGCTCGACCTCGACTGCGGCAAGTTCTTCACGGTATGCGAATGTGCGTGGATGGTGTGTATG
AACAGCAACGATGCCAATAAGATGAAGAGCTAACTGAGTGGGGGGGTGACGACGGCATGCGTGCAGGAATACATTCTGCGCTGTACATGGATCGAGCGCG
GCGGAACCCCAGAGGTGCGTATTTGAACGCTTGTTAATGGCTCTCTATATATATATGCGCATTATATATGCCGAGTTCCGGATTGTTCACGTGTTCTTGT
TGCGCGTGTAGATTTGGGACGTGGTGCGTCGATATCGAGAGTTCAGTGCCGTCGACATTTTGGTAAGCAGACTTGTTGTGCGATAACTTTGCAGAACTGT
GTTATCGGCATCAGATACATTCGTGGAAACGTTGTGATTATGGCATTACAGCTGCGTGAGAAGTATCCGTCGCGCGCGCAGTTGTTCCCGTTCCTCCCGA
GCAAAAAATACATCGGCTCGTCGCTTTCCGCCGACTTTGTCGACAAGCGCCAGCGCGATCTCGGCTATTACGTGACGTCGATTCTGCACAGCTGTCCGTT
GGTACGTCCCGCTTCCTCCAGTTCCTGTGTGTTCATTTCTTTGTGTATGTGTTCACGCGCTGTCTCGTGCTATTTCAATTGTTGTTGTTTTTTATTTTTT
TTCTATTGGCGACCTTTAGCTCGTCCAGGACGAGATCATCGACACGTTCTTGGAGATCAAGCGCCACATTCTGGAGCGTGCGCGCGACCAGGAGCGCCGG
CGCCTCGGCGGGTCCTCGTTGTCCGCGTCCTTTGCTTCGTCCAACGGCTCAGGCACGCTGCTGCGCGTTCAGGAATAGCGGAGCAGACCCCCCAGCAAGT
CAGTTCATCACGTCCATACTTTTTATATTAAAAAAAAACAAATCGTACCAACAGCATATTCCCCATGCAAGCATGCAGATAAATGCCGTTCTCATCCATT
ATCACATCCATTTTCTTAATGGGATGGAATTATGCAAATACAGAAAAAACCTCGACGTCTATCTACAACGTCGTTACAACAGTCTACCTATTCTTATTAT
AATAATACTATAGGAGAGACCGAGACTTGAAAGGAAAAAACCTCGGGGACGCTGCGAAAACAAAACAGCGACCATCACTCTGCACGGCAAGATTTTTGGG
GACTCGCTGGGCACGAGTGCGCGCGCGCAAGGGAGGGAGGGGGACTCGACGCCCGACCGCACGAAGGAAGCAGTGGCAGTGAGCAGCAGCAGCCAGCACC
GCGGTCTCTCTCGCGACGTACACGAGACGCATACACGCACGCATCTACAGGCGCGAGCGGACGAGTGGCGGGTCGTGCTGTCGTGGGTTGCGCGCATTGA
CATCGACTGGCACCGCGGACAACGACCATGGCGCTCACGGACATCATGTCGATGGAGATGAACGACAAGTACATGGAAAGCGACTCGAGCAGTTCCTCAA
GCGTGTCATCGGACTCGGAATCCGACGAGCTGTCGTCGTCGTCGTCATCGTCATCGTCGTCGTCGTCGGCATCCTCGCTGACGTCGGTTCAGCGGTCAAC
GAGTGGTGCAGCTAGCGCGCGTCAACCGCCATCAACAGCGGCCTCGAAAGCAGTGACAATGGCGCTGTCGGATGTCGATGATGATTCCGACTTAGATGCG
TCGTATGGCAGGAAAAAAGCAGCACCTGTGCGGAAGCAAAAGGCGCCCGCACCGAAGAAGAAAGCACCGGCGCGGCCAGCAGCACCGAGAAGTAAACCAC
CCGCACCGGCACGAGCTGCAGCGACGAAGAAGTCGTACGTGTCGAGCAGCAGCTCTGATGTGTCTAGCGACAGCTCCAGTTCAGGTTCTTCGGGTGGCGA
GGACTTTTCAGAAGTGGAAGAGGTGAAACGGAAACTCCTGGCGCTGAAGCAGGCGACGAAAGCCGCTGTGGCATCTTCTGCTGCTGCAAAGAAAGCTGCA
GCTGGCAAAAAGACCAAAGCGACTGGCAGAAACAGTTCCCAAGATGTTGGTCCAGAATCGCTCAAAGTGACTCTGAAGCTTCCTCCTGGGTTCATTGCAA
AAAGCAATGGGACAGACCCACCACCGCCGCCGCCACCGCCACCACCACCACCGCCAGGAGGAATGAGCGCGTCGCGCCCAGCTCCCAAGCGACAACGTAC
GATTCCAACTGCAGCGAGTCGAAAAAAGTCTACGGCAGCAGCGAAAGTTCCTGCAAACACGTCCAAATCAGCAAAGAAACCAGCAGTAGCCAACAGAAAG
GCTGGTGCGAAAACTGTAGCTGAGCCGATGCAGATTGCTCCACCAGTTCTTCTGCAAGGTCCTGCTATTCTAGAGAAGCTGATTCCAACAGGGCCAACGG
TTCCACATGGTGAAATTCGTGGCTCAAGAGAACTATCCTTTGTTGACAAAAGTTTGGCGAGTTCGCGTCCAAAAGAAGTGGACGAAACAGATATTCCAGT
GGAGTTCAACGACCCATACGCAGTGGAGAGTGATGCGCTTCGGAATTTGGACCTATTCTTTTTCTGTGACGAGCATGGGTAAGAAAGATTCTGCTGCTGT
CTCTGAATTACTGGTGCTTTGCTAACGCGCTGGTGTTTTGTGCCTACAGTAACTCAATAAGCTTGGAAATCCTTGATCGTCCAAAAGAGCAGAGACCTCG
GATCATGGGATTTGGAACTGTTGTGCAGCATTTGCCTCCAGCAGAACGTCCGCTTCCGGTGAAGCACATTCTACCTTCCCCCGCGTTCCCGTCTCGCTCA
AGAAAAAGACCTCGAAGCGACAATCCTTCTCCACGACAGCCACAGACTGCTGCTTCGTCGGTTGATCGCAAGAAAAGTATGACCTTTTTCATTGTGCATT
GTTTATCAGGACTCTTGTATTTGTCGGTGGCTGACTGTGATATGCACATTCCGCTGTAGAAGGTGTTGTGAAGCGAGATCGAAAGAAAGCTAAGGTTACG
GGAGAAACGGGTTCAATTGATCAAGGGGACGGCGAATTCGACGACGACGTGTACCGTGGCCAGTGGTCGGCATCTGGAAACATTTTCCAACAAAACTCTT
CGTTCAAGTACTCTCGGTCCAAGTTGGGTAAACGGCTGTCCCAGATGGATGGGCAATCGGATTCGGAAAGTGATGAAAGTATCATGACATCGGATGATGA
AGACCCAAAGAGTGAATCAGGGGCTCAGACTGGTGGAGAAGATAGCGAGCTTTTATCAACTGCTAGTAGCAGTTCCAGTGATAGCGGCAGTGACAATGAT
GAGAATGGGTCAAATTCTTCATCTTCCGTTAGTGGAAGTGACGTTGAGACCGGTGGAGAAAACGGAGCGAGTGACAATACTCTTGACTCTGAACCCATAC
CGCAGAAATCGAAGCAAACGTCGTCCGCAAGATCAACAAACGGAACAGGAGGCGAACAGCGTGTGACACTCAGACGTGGATCCAGATCGAAACCGAAGGC
TACGTCAGCTAACCCCGAGGTGAACGAATTGATGCGAACCGACAAAAATGTTAGCGTCGAGCCGAAGGGGACGGAAGATGAACTCAACCTGATGGAATGT
GGCTTTCGACATCCCACTGAGTACAAGCGAATGCGAGTGTGGCTACCTGAGATTACGGACTGGTGCCTGGATTATTCTGAAGGTGACCCAACGCTTTGGG
TGATTACTCCGCACGCCTGGTACAAGATAGCAGGTCCGCTTTCTGGGATGCTTCCACACATTTCGTACCGTGAAACGTTCAAGCATGTACGCATGTTGTT
TGAGTCCAGTTACTTGGTTGCGTATGTGCTGAAAGAGTGGCTGCCAATCAACAAGAAGGTGTCGTATCGAGCAACTTTGGAACAGATCGTTGAGCTGTCG
CTGAAGGGAAGATATCGAGTGGTAAGATCGTACTGTTGTTTCTCCAGTTGTACAATATTGTCACTCACGATTTCTGTGAATGCTTGTCTCTGCAGTCTGG
TTGGTTCCTGATGGAGAACTACGATTTCATTCTCAGCCAGATTTGCAATCTGTTTCCGGATAAGAACACGTATGTGGAGTCCATGTTCTTCAGGCAACTT
CATCGTTTGAGCGATAACCACAGATCTCGGGAAGAGAGGGTGAAGTCAGAACTTGCAAAGCGAGAAATTCGTCGGGCTGAGCGCGAAAGAGAGCGAGCGG
AGCGTGAGAAGGAGCGCTCTGAGCGAAAAGAGCGCATAGAGGACGAACGCAAGAAATGGAGAGACCAGCGAGAAGAAGAACGAAAGCTGAAGGAACACGA
AAAGAAGTACCCGGTTGACGATTTGGAGCTCTTGGGGGAAGCCGAGGCGTTCGAGAATAAGCTTCCGCTACCTTGTACCGATTTGGAAGGAATCACTGGG
GACTTGCTTGGAGAGCTGATAATGGCCTGGCAGACAATTTGCACGTTCAAGAACTTCGTGACGTTGGGGCCGCTGTCACTCGAAGGTCTCGTGCACCGAA
TGACCACGAAATGCGATGAAGGGACTGATATCGGTCTCATGCAGATCTTCCTGGCGTTTTTACGTGCGATTTTGGCAGAGAAATCGTTCACGTCGCTGAT
GGATGACATTGTCGTGGAAGGAAACATCAAGGTTTCGGATTTGTTCGTAAACAGCGAACGAACCTACGGGATTTGCGAGCGACCATACAAGGATATGCTG
AACATTATCACGTGGCAGGATATTTTGCGGCAGCTGATGTCAAAAGATCTCGGGATTGATGCCTCTATTGGTCATGTTGAACCGTTGGTTGGCTGTGAAG
TTGTTCGTCAAACGTTGTACATGCAGACAGTGTCAGCACCGTTTAACACGCCGGTTGACACGTCACTGAAGGGGCTGGAAGATTACACTCAAATTATCAA
GCAGCCGATGGATTTGGGGACAATCAAAACGAAGCTCGATTCCGGTGGGTACGAAGGCCCTCAGGGGTATGAACGTTTCGCTGCAGACGTTCGATTGGTC
TGGGAGAATGCACTTTTGTACAATGGGGAGGACTCCGAAATCGGACGTTCGGCGCTTGGGTTGTCGGATATCTTTGAGCAAGATTACCAGAGATTCGTTG
TTGGCCCTCTTAGAGCCAATGACGATCGAATTGAAGGCTGCAAGAAGGTGAAGGCTGAGCTGCAGGAACGGTTTGCGCAGCAAACACAACCTTCGTCCAG
CTATGTTGACATTGTTCATGCGTTGTACGCTTTCGAGTTCCATGAGGTGAGTAGGCTTCGCCGTTTCATCTTATGAGTGTGCTTGGGTACTGACGTGCTT
TATTCACTTTATAGCTGCCAATATCGTACAAAGTTGGCGCGCTGTCGTGGTTATGCTCCGAGTTCCTGAAGTTGGATAGTATCAGGTACGAAGTGACGAG
TTTGTTGTTGTTGAAATGGTGGAAGATGAATGGCGGCGAACTTATTTGCTTCAAAACATACAAATAGAACGTACATTGAAGCTCAGATGGAACATGAAGT
CTCGATCGTTCGCGATCACCGCAAGCGAGCTGCTGAACTGGAGGCCAGACGAAAGCATGCTGAGAAGGTCCGACGCGAAAAAGAGGCTGCCTTCAGGAAA
GAATGCATCAGTCAAGGCATTTTACCGAATTCGCAGAACATCTTTTCGGAGGCTATGCGGGAAAAGTACGATTTCATTGCAACATTTTACAAAGAAATTC
ACCTGACGAGCGCAAGTGAGGATGGAGCTTTCGACCAGGACAAGAAGAATCAGATTGAAGAGATGAAGGCTGAACTGCGCGCGGTAATACTCCGGTGTTT
GCTTATCTAGCCGTACTTGTGTTCCAACTGACATGCCTTCGTTTATGTTCACCAGGTTATTGTCCGCGAACTGCCGTTGGGTAAAGACCGATACCACAAT
TGCTACTGGGTATTCAAGAACGACACGTGTCAGCGATTGTTTATTGAGAAGTGTGATTCAGGTCACTTTGTGATTTGCAAAACAAGCACGGAATTGCACA
CGCTGCTGGACTGGCTGAACCCAAAGGGTAGTCGTGAGATGGCGTTACTTTCGAAGCTGACCTCACTCAAAGAAACCCTCCTTCAAAACATGCAGGAGAC
AGCAGAAGGGGCCTCGGATGAGATTGCTTCGAAAGCAAGTGGTGACATCAAGGTAAATTTGTTCCCATTGCCTTGCGGTGACATCAAGCAAGACTATTTG
ATCGTTAACGACAAGGAAGGATGGCTGAGCAGTCACTCGATCGTCCAGAAGATGCTCTTATCGCTTCGAAAGCATTTAACTGTCGCTGGCATTCTGCATG
ACGAATGGGATTCATCTACGTCGTGGAGTAGTCGTGTCCAAGAGTCCAAGTCGTTTAATGCTGTGCGCGCATTGTTTGCAGAGCTGGAAGATACAGTTGT
GGCGTCAACTACTGCTGCAGAAACGTTGCGTTTATCGTGGCAGAGAAAGCGTCGTGAATGGAGACTGGCGTTAGAAGGAGCGTGCACGTACGCACAGTTG
GTGTTCCTGCTCCATTTGCTTCTGGAAGAGTGCATCAATGTGGCTGCATTCATGGATCAATATGTCCGACTTGACCGAAAAGAGTGGTTCCAGCTACGCC
TGAAAGATTGCCGAAACTTTATCCCAGAAGTCGGTAAACAGGTTGTATACTTTGGCGATGGCCATGCGCAAGCGCTGAAAGAAGACGCCAAGACGAAAAA
GAAAAGATTTGCCCAGAAAAGTGATCTACCGCGAGCGAGAACGACGTTGATATGCACTGTGGAGAAAATTTCCTATCATCACGGCGGCGGTGACCCGTAT
GCTCTTGTAGTTTTGCACCCAACCAAAGACGGATCTGCCCATAGTTGTATTCGTGAACCCGGCGCCCTGCTTTGCCCACAGCCATCTCCATTGCAACGTC
TATCGCGGATTTTCCTTCGCATTTTGAGTAAGCTGAAGTCGCACTCTGATGCGGGTCCATTTTTGGAGGCTGTGTCCGATCGCGATTTTCCGGAATACAA
GGAGATAGTGCTGCAACCAATGAATTTCGGCAAGATGATGGAGAAAGCCAAGACGCTGCAGTACCAATCCGCCAGCGAGTTGCTTGCGGATGTGAAGCTC
ATTTGCAACAACTGTGAGCTCTTTTGTGAAGGCCGCTTCCCAGCGCTTCCGCCGTTAGCACGGAACTTGGTTGAAATGGCTGAAGGCTTGGTCAAGCGCT
CGAACAAGGATATCCGTGCTTGCGAGAAGTCTATGGGTAATGCTGATGCCACTCTATCACCCGAGAAGGTTGTGAAGTCACCAGAGACGAGCGGTGAGAG
CAAGGAAGCAGCTGACAAAGAGATGAGCAGTGGAGATCAGGTTGACACGACGAAGCCTATCACTGCGATCTTGCGTCTCGAAAATCGTTTACCAGAGTAC
GTGGTTGACATGAAGCGGTATGAGAGTGCTGTCAGTCATACCCGGAGCTGTGGAGAAAAGTTTCGTATGCTGTTTCGAGACCCGCAAGGGTTCCCTGGCG
AGTATTACAGCGGCGTTGCAGCTGGATCGCTGCCTTTCGATTCAAATGGCTTGCTACCATGGGAAGCACTGCGAGTCACTTGGGACGAAGACGATGGATC
TGACGACAGTCGCATCAATCCTTGGTACGTTTTGGCTGTATCTGCAGTGCATTAATGCACGTGTACTGACGATTTTCTTCGTTCTTTGTGCAACAAATGT
TCAGGGAGGCGGAGTTT