Description :
From Genome Similarity Track
Location :
Scaffold_11:327722- 331052
Sequence
3330 bases(100 bases per row)
ACAACTCCCCTTCGCGATAAACACCGCCCAAGACAGGATCCGGGGTAATACCCCATTTTACTTGGTACATGGGTGGGATCCCAAATCCACCCTGGAAGCG
GCCATCCCAGTATACAGCACCAAGAAGAGAAACCGAGATCCAAGGCGATGGCGATACCAAGTCCAGAAATACTACCGGCAAGCTAGATCCCAGGTGAACG
AACGACTGCGGAGTGCGATACAGGATCGAGCGGATCGACACAACGAAGACGCCCGTCCACATCAAATCCAAGTAGGATCGCAGGTGTGGCTTTATTTAGA
TCGAGTGAAGAAGGGTACGCCCGCAAATTGGCCCATCTATGGCATGGACCGTTCCGGGTGAGCAAAAAGATAGGGGAACATGCGGTAAAGCTGGAAACGG
CAGGTACCGAATGTCGCTTGTTCCCTGTAGTACACGTATCGAAGCTGAAGTTGGTCAAGGAATATCCGGATCGGCCGCAAACCCGTCTTTCGGTGGATGG
ATCCGACCGGGTGGATTTCGACGAAGTCCTCCTACCGGAAGATAGTTGGAATGTGGATCGCGAGGCCGACGAGTTCGAAGTCGAGAAGATCACCGACATG
AGGTCAGGGAAGCGAACTAGATACGGACGGATTTATTGTGAATTTCTAGTGTATTGGCGTGGATATGACGAACCCAGTTGGGTAGACGAGGCAGATCTGA
ACTGTGGAGCATTACTCTATAATTTCTTGCGGGATCGTACGAATCGTAACAGATTCGGCGTGATGCAGTCTCATGAAGAAGAGTAGGGAAGGGACCCATG
TATGTGAGTTGGTCATGTCGATGAGAGGATGAATAGGACCCACAGGAAGGGTGTGGGTCGGGAGGAGGAGGATCGCTGATGTGAGTTGGTCACATCGGAA
AGAAAGAGAAGACGAATCCACAGGAGGAGAATGGATTAGGAGGAAGGAGTGAATGTTTATGCATTAAGCGTGACGTTTTACATGCGAAGAGTCCTGCTTG
GTTTAAAGCGCGAGCTTTCGAGAGCCCGAGCTATACTGACCCAATTGAGACTGAGTCGTAGGCGCTGGATCCGGAGGAAACCCAAGCGTGGATCCAACCC
GGATCTAGAATCCAGCCCAGATCCAGGTGTACGCTGAAAGGGTGGATCCAGCCCAGATCCAGGTGTACACCGGTAGACTCTGACCGGATTCCTCTACCAA
CATAAAAATGTTACAGACATATTCAAGTAAGAGAGTGTGAATTATAATAGCTTAAGCAAAAAGGCTAGCTCGACCCAGTTTCCAGTCGCTAGCTACTACT
ACGAAGCGAATCCACGAAGACTGAAACTGGGGGCGTGGCGTCAAAGAATGATAGGGATCAGGTGGTCTTGGGCTGAACATTGAAGAACTTGCCCACCAGA
CGCTGGACCTGGTGTCCTGGGTGTTGGCTCGGGTCCCCACGAAACTTAATGCGCCAAGGCTCGGCTTCATCAATCTCTTGCAAGGCCTCCAGTAGGTTCG
TGGGCTCTGGGCGATGGAGGTTGGGATCCTTCAAGTTGGCTTGACGGGATACGGATCCCGGAAACCAAGCTACTTTATCCCCGGGTCGGGGAAGATGCAA
GAAGGATGGATCCAACAAAACATCCACGTCACACCAACCGTCCTGGATCGCCAACACGAGGATCACGAGGACTTTCTTCCAGGCTCGACCGGCATGGCTA
CGTCGGTTACCACGCTGCTTGTTGAAGTTGGACAACCAAGTCGAACCCCGCAGTTGATTGCGAGAGATAGGGAATCGGAGTGACTTCCCATATGGCAACC
CGGTGCTTGGAAACGAAATCCCGGAACGCGCGAACAAACAACCCGAGACGCCCGCGCACATACACCCCTGAAGCTAACCGGATCCACCAGTGTGGTGGCC
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAAACGTTTTTTCCACGCTTGTTGGAGAGCTACACCAAAGGATTATGTTTGACAGCACAGTTCTCTT
CTCATGCCATTTAGCGACCATCCTTGTTGAAAGTTCAATATCTTCCACCCCATTAAGAATAGATAGACTCTCTCTCACCCCTTCTGTTGATAAGTACCTT
TCATTAAAAATACTAGATTAGGAGGAAAACCCAAACAAACAAACAAACAGATCGTATTTTTACCTGAACCCGCTTCGCTTCTCTATTTAAGTAAATGTAC
GCTTTCGGACGAAAGTATAGTTAATCTAAG