Description :
From Genome Similarity Track
Location :
contig_62:3277- 7372
Transcript NameFunction/comments
g11386.t1OWZ02172.1 reverse transcriptase [Phytophthora megakarya

Sequence
4095 bases(100 bases per row)
ATACATCCCACTCCTCCAAAACTGCAGCCTTCCTGCAGTTCCTTCTTCAATTTCCCCCCGGCGTGGCCAACCCACACCAACGAGTCCCGCCTCACTATTC
TTCCTGAGACTGCATCACACCAAATCGGTTGTGATTCGCGCGATCCCGTAGGAACTCATGTAACAACGCACCACAGTTGAGATCCGCTTCATCGATCCAG
CTGGGCTCCTCATATCCACGCCAGTGTACTAAGAATTCACGATAGATCCGTCCATATCTCGTACGTTTGCCGGACCTCAGATCCGTGATCTTCTCGACTT
CGTTTTCATCGGATCCAAGATCCGAGATCCAACTATCTTCCGGTAATAGCGCTTCATCGAAATCTAGCCGATCTACACTGTCCACAACCAGCTGAACGAG
CGGGCGATCTGGGAATTCCTTCACCAACTTCAATTTCGATACATGTACCACCGGGAACAAACGGTAATCCGTTCCGGCAGTTTCGAGCTTGACCGCGTAC
TCATGGATTTTCTCTGCCACTCGAAATGGCCCGTGCCACAAGTGCGCCAACTTACGGGCGTAACCTTCTTTCACGCGATCCAGGTATAGCCAGACGCGAG
ATCCAGCTTCTATCGGGTGGGGTCGGACGTCGTCATTGTGCGAATCTGCTCGATCTGCGATCGCCTCACGGAGCTTTTCGTTGACTTGTTCACGGACCCG
CGTATAATAACGCTGGATCCGGTAGCGCCATCGGCGTGGATCACGATCTTGACGTCGAGTACTACCCACCGGGATCGTGGCCTCTAATGTAGACCTAGGA
TCCCACCCATGTACCAAATAGAAAGGCGTATCACCTCGGATCCGATCTTGGGCTGTGTTAAGGGCAAACGTAAGCCGCTCGGCGTACTCGTCTCAATCCT
GTTGATCCAGATCCTGGACATGCATCTTGAGTGCGCGCGTGATCGTTTGAACCATGCGCTCCGCCGTCCCATTCGCTTGCGGTCGGTAAGCCATAGTGGC
CCTCTGACGCTGTCCTAGGATCTTGTTGAACGCTCGGAAGAAGTCGGACATAAATCCTGGTTCCCGATCGTGCCGAATTACCTCGCTTGCGCCAAATCGG
CGGAACACACATTCTTCGTAGGATTCCGCTATCGTTTGAGCCGTCCTGGATGAGCTGGCCTTGGCCATCACATAGCCAGTGAACAGATCAACCCAGATCA
GCAACTCCGTGTTGCCTCTATGCGATTTCGGCAGCGAAGGTATGTGATCCATGGCTATGATCTGGAACGGATAGGTTGCTTGGATATTCCCTGGTGACTC
GCCTCGGATAGTGGGCCGACCTTTTCCGGTCTCGCAGTCTACACATTCCCCAACATACCGTTGGACACTCCGGTACAGGCCTCTCCAGTGGAAATGATCT
CGGATCCGCTGGTAAGTGCGGCCGATCCCTTGGTGGCCTCCCTCTACACTAGCATGGTAGTGGTGCAGGATATCCTGATGGAGGGTTTCGGGTGCGACCA
ACCGCATCGCGAGATCTCGATCTTCGTCAGACTTCCGGTTTGGTGGACAGTAGAAGCGTAATCCGTCCAAATCCATCTCGTAATCCATTGCCAGATTGCT
GTAGGATCGATCTTCTTCCTGGGTCCAAGTAGCTACATCGCCAGCCAGATACTTCTTCATTCCGGCGATCCATGACTCTTCGTCTTGGGCCCAGCGAATT
CACCCTATCCTGAGCTCCCTCACCAATTCTTTCTGCATTACCTTCGGACTAGATCCGGATCTGACTCCAGATCGGGTGGGTCACCGGCGAGATCTGGACC
ACGGATTCCTCGGAGTGCACGGTCAGAATCTCGTCCAACCGGTTTAGGGTCACCAAATCCGGATAGTCTTCCTCGTCCACTAGGATCCCCAATTGCCGCT
GAAGGGCAGCTCCGGCGAGGCTGTCAGCGGAACCGTTCCAATCTCGCTTAACATGTAGCAGCTCGTGATCTGGCCACTCTCGCACTCGATCTAGAGCTTT
CTGTTTCAACAGAACCACACCTGGGGCCTTACAATGAATTTCCCCTCTCACTTGCCGGATCACCAGGGTTCGAATCCCCGCAGATCACTAGACGTCCACG
CTCCACTTCAGCCAGGAGGTCGAAACACAACAAGAGACCATTATACTCCGCTTCATTCACCGTCATCCCTTCTGCATAACCCGATCGGGCTTTCAGCACG
GTCCATTCTGGTAGTTTCCACAGGATCGCGCTGTACGCGCCTCCTCCTCGTTTTACTCGGGCCGATCCGTCAAAGCTTACCACGTACAATTCTTCATCAG
CCTTCACCGTGGGTACAGGAGCTTGGATCTGCCGTCGGGGCTCTTTCTTAGGCGCGATCGCGATCAACGCCTCTTCCACATCGGACCTAGGTGTAATACT
GGCAGCCATCGCCCCTAGGATTTCGTCTTCCCTTTGGTGCACTTCATAATTTCAAGTGTCCATGGCGACAGAAGAGCTGCCCATTGACCCAGACGTCCCT
GTAGCCCCGGCGATCGGAACAACCATGCTAACGTCGAATGTCGAGTTAGGATCCGGATCTCACGTCCTACCAGAAGGTTGTAATTCAGATCCAAGATCCG
TAGCAACGCCAACACTTCCTTCTCGACCACATTATAATTCAGCTCGTTCGACTTCAGTGTCCGACTGGCGAAAGTGACCGGATAGTAGATCTGATCGTGA
CTCTGCATCAAGGCGGCGGAAATAGCCCATTCGCTAGCGAAGACAACTACTACTGGGAGTAAATCGGGATCGAAGTGGCGCAGAATTGGAGCGGTGGCGA
TCTTGTCCTTCAACGCTGCAAACGACCTATATGCTCTGACCCATCTCTCGTCAGCTGCATCTACACCTGACATTACCGGGGTTGCAGTAGTTGAGTGGGA
GATCTCGGGATCGGGTTCAGACGAACTGTGATCCAGGATCCGACGAAGATCTGGGCGCTTCTTCAACTCAGCGAACTCCACTTCGCGTAATTCATATAGA
ACGGCAGCATAGATCGCATAGTCCTCGATAAATCGGCTGTAATAGTTCAGGCTGCCCAAAAACGACTGCATGGATCTGAGTGATCCCGGAAAAGGTAGAT
CCGTCAAAGTCTTCAAGTCCTTCGGATTAGCTTCGATGCCATCGTCGGACACTCGATGTCCCAAGTATTCCACCCGGGGAAGACCCCAGAAACTCTTCAC
CACACTTATAGACAGGTTCCATTTATCACACGCTTCGAGCAGATTCTCCACTCGGTGGCACAGTTGATCCCAAGATCCAGCTGTTACCAAGATGTCATCG
ATGTAGGATCTGCGTCCTAACACTGACGGACGGCCTGGATCTTCCGGTTCTCCAGCCTCAAATGGATCTGGAGCAAGTCCTGGCTCGTCAGTAGGCGGGA
TCCGTGTAAACCCATATAACGCGTTATCCAGAAGCCGCTGATAGATCTGAGGCGCATTCTTGAGTCCGAAAGGCATCCGGTTCCACTCGAACAGGCCGAA
CGGAGTTATGAAAGCCGAGATCGCACGAGCTCGGTCCGTCATAGGTACGACCCAAAATCCGCTTGCCATGTCCAGCGAGCAGTACCAGGACACCTTGTTC
AGATCCTCCAATAGATCATTAATCAGAGGCAAGGGGTAGATCATCAGTCGAGTGAGGCCATTCACCAGTCGGTCCCGTTCTTCTTGATGATCACCACGAT
CGGTGATGCCCACGGCGATGTCGAATGTCGAATCATCTTTGCTGACAGCAACCCCTTGATCAGATCTGACACCTTCTCCCGGAACTGCGGTGCTATCTTC
CGCACCCGTTGCACGATCGGCTTTGCGTCCCCTACATCGATATCACATACGACTCCTCGGGCTGCTGGCGGTAAGGCATTACCTTTGCCTATCAACAAGT
GTCGTTTCTGCCAGATGATCTGCCGCAGACGATCGATCTCATCTGGAGTGCTGCGATCTGGATCACCCACCTGGATATCGTCAATGGTCACTTCGCTCGT
CATAGCCGTGATCTCTGGCAATACTGCCATCTCGCCTTCCACATCTTCAGCTAGCAGATCACCAGCTTCGTGGTGATAAATATGTTCATCTTCCA