Description :
From Genome Similarity Track
Location :
contig_47:327689- 331776
Transcript NameFunction/comments
g9702.t1XP_008890438.1 hypothetical protein PPTG_00734 [Phytophthora parasitica INRA-310
g9703.t1XP_009523409.1 hypothetical protein PHYSODRAFT_354328 [Phytophthora sojae

Sequence
4087 bases(100 bases per row)
CGGTACTGGACGTTCTCGCCGTGGTTGGCATCCATGCTGGCGAACAAATCAGAAGCTCTCGCTCGTGCGTATGTAGTCGAGTTGTTCACGACAGGCCTTT
TGCAACCATGTGAGATTGCAATTCATTGTCTGCACCAGTGAGTCATCTATTGACTGTACATGTATTTTCTTACGCACTTTGCATTTACTTTAGGGGAGCG
CGAGTTTGCAGAGCGTGTTGCACGCTGGTTTTGCAGGGTGAAGGTGTGCAAGTCGTACTTGAACCAGCTTTGGCAAAGTTGGATCCCCATTTGCAGCAAA
CCTACTTCAAGGTAAATGCAAGCAAGTAGTTGCGACGGAATTATCTCTTAGTTCCATGCCGACGCAGAACATCGACGACATCGTGATGATTATTGCGGAG
TGCTAGGTCGGTTGCAGTGGGGTAAGGCACTTGTAGGAGTGGCAATGCAGTATCCGCGCCCTCGCCAATCAGTGCAGCACAGCAGTCTGCGAATCCTTCT
TCTCCAGCGATCAGCACTGCAGTATATCCGAAGCGATTACGTTGGTTGATCAGTGACCGAGTCCATACTTCGTCGAGGTATGACGATTGGCGAAGGTGGC
GCAGTATCAGCTGCAGGGAAATTAGCGCGTTGGATGCAGTTGCAATATGTAGAACTGAATTCCCATCGGCATCCGTCACAAGAACTCCTGCTCCATGGCT
AGCGTATATTGATAGCTCTAGTTAGTAAATCTGTCCGAGACAAGTTCATCGTACGAACACTTACTGAAGAAGGTAGCTGGCAACATCGTGTGCATCCCAA
GCGCATGCATACTGCAGAGCTGTGCGACCCGTGTGATGCCGTTCGTCCAGCAGTGTCGGATTGTCGGTATAAAGAATGGCAAGAGCACAAACATCGTTGT
TCCAACGGCTTCCATCCACTGGTCCAGGAGCTCCATCTGATCAGTCGCGTGAAAATAATGATCAATTTATTAGGAAGGCACTACATAGTGCATGGCCCGG
CATATTTGGTCGATACAACATCAGTCAGTGGTGAAGCCGTACACCTCGGTCTCCAGCACCGCGTACAGCACAGCCTTCAACTCGTCGCGAACAACGTGCA
GTGGCAGGTCCAAACGATTGAAACAAGCGTGGCTGTGAATGAACCCGTCACCAATCAGCGACACGGCCTTCAGTGTAAACGGGCACAGACGACCATCGTA
GCTCGTCAACGCACTGAACCCTCCGAGAGGAACGCGCGATGAACCAGTTGAAAACTGCAGCAGCCGACGACGATACTCATTTGGCATCTCTCGCACTAGC
TCCCAGAACCACTTGAGTGAGCGGTGGTGGTGAAGGTCTTCCGAATACTTTGTGTTGCGCTCCCAGTCATCTACGTCGATCTCGTCGGAGCCGCACAGCA
GGAAGTCGAACTCTTCCGGGTCGAATAGCAGGAGAAGTTCGCGAGGGACGATTTCGTACAGGCCCTGCAAGAAGACTTGCAGTTGAGGGGCCACACTTTC
CACAAGCAGGTATTGCCACTTGAGCTCCACGAACTCGCGCTTGTTGGAATCGGTGACGGGAATGGCACTGCCGCCAGGCACGAGCTCGATATCGCGATAG
CTATCTCCATCCTTGGTAGTCACGGTGAAATCGAGATCTAGCGCATCGACATTGTCGTTCTCCAGTAACCAACGCAAATTGCTGTACACCTCTGGGTCCA
AGTCCTCCAAATCTTCAAAACTTAACGGGTACCCAGAATCAGCTTGAGGAGAGGTGAACCAAGTGGAAGCACAGCATAGAACCTTCGAGCAGTGCGCGAC
CCAGGAGACGGCCGGCCGCATACAAATGCAGGAGTCGATCCGGCAAAAGATCCATGTTTGAGCAGGGGCTCAAAAAGTAGGCTTGCTCATTTTTGTTGGC
ATATACAAAGAGACCGCGAGCAGGATCCACGAGCATCTCGTTCAGCATCACGAACCACTCGCGATGAAGTCCTCCCGCATCCACTCCACTTTCATCCAGG
AAATTAATCCGAAGCACAGAGTGGAGGTTTCGTAAGGGGATAATGGCGAGGGACTCCATAGAGTCCTCGAACACATTGGCACGCTCCACATTAAGCCTCA
AATGCTCTCTCTCCGCTGGAACCAAGAGTGTTGACGTGGCGGTAACGAAATGCGCATACTTCGAGGGGAAGTCTTTGCTTGCGAGAGCTATAGTCTCGCT
CGGCGGCGGCGATGTCGTTGTGGTCTCACGTAAGCTGCTATTTGGCGCATTTAATTCTGCGCTTCGAGGTCCAATCTCAATTTCCAGGGGCAGTTTCGAA
GCGTCCACAGTGGTGTCAGAGGCTGTCGTGAGTACTGTGTGCGTTGCTTGGGAATTGTGTACCAAGTTGGTAATGCATTCTTCCACAGATCCGAGCAATG
GTTCCTGCTCTCGTATGCTGTCCGTCCAAGCGTATTCGCGTTCTCTGCTGCAGCCAGTTCGTGTTCTGGTTCGGGTTCGGCCGCATCCGTTCCAACAGAA
GATGCCGTTTCCGTATTGTCAAAGGCAATTCGTGATGGTGCAGCCGGTAGCAGTGGTGAACCATTATCTCTAAGAAGGACAGTTGATAGCTCTTCCGACA
CGGATTCTTTATCACCTTCACACGTCGTCGCTCCTTGTTGAAGCAATGGCAAAGCATCAATCCCATTGGACTCACCACAAGTAGACAGGAACTTGACAAC
AAATCCCGTGAATCGCGTGTCCGTCCATCGTCCATCACGGAACCAGAACGTGCGTCCTTCAACGTCCACTTTCCTCGTCCACTCTTTGCGTCGCTGTGCC
CGTAGTCGACGTCGAGTCGTTTGGTGCGTCGGCGTAGCCGTGACCAACTGCACGCGACTCTCTCGCTTGAACAGCGGCAAGAACGATAGTCTCGGTGCCT
TCTTGTCTCCGTTTTGCTGTTCGTCGTCCGCGAGCGCCTGTCCGCACACGGTGCAGAACTTGACACGTCTGAAGTTCTCGAAGCTGCAGACTGCGCAAAC
GTTGAATCCCTCCTCCGCGTCTCTCAATGCCGCGTCCAGTCGTCGATCGTCAGAGCTGCAGCAATTGCAAAGTTAGTGTAACTGGGGCCTCAACGGAAGA
GCAACGACGCACTTGAGCAGCGGCGCGTGCAGCTCCAGCGACCGCTGGCGACGGATGTAGGCGCGTCTCGCTAACAGCGACAAGCAGCAGAAGAGCAGCG
CGATGACTGCCAGCACAGCGAGGAAGCCCACCACGGCCTGCATGTCGTCTCCGGATGAATCTGAGTGTGGCGTGCGTCAAGCATCTGCGATCGATTACCG
AACTGGTAGATGCAAAAGTGTTTGTCATGGGTATAGTTTAGATAGATTATAAGAAATGAATAAAGAGGAGAGGAGAGACTTTTGAGGAGTACTGTTGTGT
CCAGGTAGCGGTACAGCAGATGAGTGTTGAGCTGCGGGCACCGTACACCGAACGCCGACCGTGCTGATCAACAGGATGTTGCTACATGGCAGGAGCTAGG
AAGGCACAGGGCAATGTATATCGCACTCACTTACTTAATATCACTCTAGTCTGCACCCAATAAACTTCACTAATCGGTTGTAAACCCGTACACCTCGGTC
TCCAGCACCGCGTACAGCACAGCCTTCAACTCGTCGCGAACAACGTGCAGTGGCAGGTCCAAACGATTGAAACAAGCGTGGCTGTGAATGAACCCGTCAC
CAATCAGCGACACGGCCTTCAGTGTAAACGGGCACAGACGACCATCGTAGCTCGTCAACGCACTGAACCCTCCGAGAGGAACGCGCGATGAACCAGTTGA
AAACTGCAGCAGCCGACGACGATACTCATTTGGCATCTCTCGCACTAGCTCCCAGAACCACTTGAGTGAGCGGTGGTGGTGAAGGTCTTCCGAATACTTT
GTGTTGCGCTCCCAGTCATCTACGTCGATCTCGTCGGAGCCGCACAGCAGGAAGTCGAACTCTTCCGGGTCGAATAGCAGGAGAAGTTCGCGAGGGACGA
TTTCGTACAGGCCCTGCAAGAAGACTTGCAGTTGAGGGGCCACACTTTCCACAAGCAGGTATTGCCACTTGAGCTCCACGAACTCGC