Description :
From Genome Similarity Track
Location :
Scaffold_1074:3276- 4284
Sequence
1008 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GAAGAATCAGCTTCAGTACCCCTCCAACGGGAGTCAGCACGAAATCGTCGCTGCGTCTGCTCGCGCAAAAGTGACAATCAGGATTCGTTTACGCTGCTCA
GCGGAGATCACAAGAAATGGGTCGATTCCCACAGAGCTTGGGCGATGGCTATCCACGAAACCTTTATACGCCTCGACCACTTTTTCGAACCAACCGGAAG
GCTTGAAGGAGATCGGGTGTATGGTTTGATCATAAAGGCCTCAAGGTTGTTGATCGTAAAATGGTCAACTTGGTCGACGTGATCAACTGGGATGACCAGG
ACGACTCGGGAGGCGAGCGAACTTTGCCCAGTTGGACCGGGCAGATATATCCCTTGGGCTTTGAAAAGTGATGATAGAACAACTCTGTGTCCAGCTCCGA
TACGCTGATCAGGCTCACTCTTCGGGCGGACCAAGGGGACACATTTACTGCCGATCGCGGAACCCGATCGCGATACCCCGGAATCCAACGATCGCTGGGT
ATGTGGGTGTCAGGAAGTGCCGAAAATTCTTCAGGAGTCAGCAGTGAATTACAGGGACTCCGAGAATCACCAGAGAGGCTGAGTTCACCTTCAGAGTCGC
TTGAAGGTTCTCCAAATAAATCCACCATGGATATTCGCGAGGGACTACCTTGAGGTTGGTGTTCCAGACTGGGGGAATCAACGCTGATCGGTGGAGATTT
CGGAGCAGGTGATGATTTCTTGGAAGGCGATGCAGTTCCACGTCGGGCAGCAGAACGGGAAGACGATAATGCCGCCAGCAGAGAATCATCGGTATCAGCA
GAAGAAGA