Description :
From Genome Similarity Track
Location :
Scaffold_219:32759- 34106
Sequence
1347 bases(100 bases per row)
CCCGTTACACCTGGTAGCACTTTGTAGTCCATCCAACGACTATAAACATGTTGGATGATGAAGCGGAAGACTTCCATCCAACGACGAGAGCTATTCCCAT
TTGAGTCAAATCGAATGAGATGCTGTCGAACGCTTAAGTTCGACGATAGGGCAAGAAGCCGTAGGCGCAATGCTGTCCGCTCTTGGTCCAAACGGGCAAC
ACACCACCATCGCTAAATTCATTCAGAATGAACTTGACGCTGAGCGGGAAAAAGTAACCTTGCAGAGTAATCAACAGTTCGAGTTGTTGAGACAGCAGCA
GGCTACTTCCACCGGGTCTACACACTCACGTCGATCCGAATCACTGAATATTGACATCTCCAAATACAAAGCAGCTGAAGAAGATTCTCTGCTGAGTTGG
TTGGTTGATCTAGATGACGCCATAAGGGCTCGTCACATCGTCGATGAGCAAATGCAGGTCGTATTTGCTCAGTCGAACTTGGCAGGGCGTGCGAAGACTT
GGGCCTTAGGCCTCGAGCTACACGACCAATTTGTGTTTGGGTCGTTAGAAGTCTTCAAGCTCCTGCTTAGGCAAACATACGAACCAACACGAGCTGAGCT
CAGGGCTTGCTCTGAACTCCTGAAAACTCAAACAAGGCAAACGTGATGTACACTCGTACATTCAGTACATACGTCATCTTTCAAGTTGCGTCACGTCCAA
TCCGCCGAATGAACAAACGTTGATCACGTTGTTCATTCAGGGTCTCACAGAAGGTCCAGTCAGGACCCATCTCTTCCGGTTGGAATTTGATACCCTGGAA
GAGGCAATCCGAGTTGCAGAACAAGAAGATTTCAGTGTGAAACAAGCTCACGTGAGTTCAAACTCCTATCGTCCCCCGAGGTGACAGCAAAGTGGAGGCC
CAGAGCCTATGGAACTCTGTTACGCTGAGAGTGAAATCTCTCGCGTTACCAATTATTAGAAATTGCAGACATGCAATAGATGTCAAAAGACAAGGCATTA
TGCATACGAATGCAGTGCCCCGAATGCGGTACCACGTACCGCAGAAACAGTAATTGTCAAGCGGACAAGAAGGGTCCAAGGCGTGGAACCGACGCTGCTG
CGAAAACGCAATATCGTAAGGGACGTCCAAAAACGGTCAGGGTCAGTAGGTGCGGAGAACCATACTGATTTAACAACTTCAAGTGAATTTGCAGGACTCT
TGGCGAGAATTGCTCCCATCACGCAATCATTATGTATATCTGCATCTGGTAATGAGGTATCTCTCATTACCTTGAAGCTCGAAGTGGCAAAGGACATGTC
ACTACGAGCCCTAGTTGATTGTGGGGCGTCAAACAACTTTCTACAAC