Description :
From Genome Similarity Track
Location :
scaffold_798:3275- 6979
Transcript NameFunction/comments
Pl_102360hypothetical protein PHYSODRAFT_340298
Pl_102361hypothetical protein PHYSODRAFT_340908

Sequence
3704 bases(100 bases per row)
GGTATGGTCCGTGACTTAGATGTTAGAGATGCAAAGCCTGGGACTCAGCGCCCAAGGCCTATCGCGCCTCACGTCGCTATCAAGGTGTACGAGCTGCTGA
AGAAGCTTTTGGAGACCAAGTTGATTGAACACTCTGAATCTCCATGGGCTTCTCCGATCGTAATCGTCTTGAAGAAGAACGGAATTGACATTCGCATGTG
TATCGATTTCCGAGTGGTTTCATCCGGCTCTCTAACTACCCCTCCCGCTGATCGACGACCTGTTGACCGGTTTTGAGGATGCGATGTGGTTCATGAGCCT
GGATATGGCTAGTGGCTTTTGGGCAATCCAAATGACCGAACGAGCCAAGTTGATCTCTGCATTTGTGTGTCCATTCGGACACTTCCAGTGGGTGCGAATG
CCCTTCGGACTTAAAAAGGCTCCACTGGTCTACCAGTACATGATCAACAGTTGCTTGTGGGATTCGTGAGATGACCACCTGAAGGGGAGTTTTTCGTGGA
TGAAGACATTTTGAATTATCTGGAGCTAGCGCCACAGAGAGCCGAGGAACAGCAAGTGGACCTTCACATGACGGCGTTGATGGAAGAGATGACGGTTTTC
AGGCGAAACATCCCTGCGCCACCCCAAATGGGCCCTGTCTTGGGGTGTAGCTCCTATATAGACGATATTTCTCATGGTGCCAAGACTTGGGATGAGTTGT
GTAAAGACCTGGATGCGTAACGCTATCGGTTGTGGTACTGGAACATTTTCAGTTAGCTTACCCAAGAGTGAATTTGGGAAGCGGACCATGCCGTTCCTAT
CGCACGAGATCGGCGCGGAAGGCATTCGCGCCATCCTGAAAATAGTGAAGGATATCCAGGATCTCCCGTTCCCGTCGACTCTGAAAGGAGTCCAGTCTTT
CCTAGGTAATATCAACTACTAACACAAGTTCATCGAAGACTTTCCGGTGGTAGCGGCAGTTCTCTATGAGCTGTCAGATGAGCAAGTACGAGCTGGGAGA
GACTTATCTCGAGCCAAAGAAGCGTTTAGTATCCTGAAGCAGAAGATCGTGTCTACTCCCATGCTCAGGCACCCCGGACTGGACTAAGCCGTTTGTCGTC
ATACCGCATGCCAACCAGTGGGTAGCTTGCGCTGTTCTGGGGCAGGAACATGACGGGCTCATTCAACCTGTCCGATTCACGGGGCGCGTCCTTAATGACG
CTGAACTGAGGTACCACATTGCCGAGAAAGAAGTATTGGCTGTGATTCGGGTTCTCCATGTGTTTAAGATCCTGGTCCTCTCGCGATCTACACTAGACAT
TCCGTTCTGAAGTGGGTGGTCAAGTCCAAGACCACAGACGGGCACTTGGCGCCTTGGGGTTTCGCTCTGTCACAGTACGATCTGGAGATCCGAAAGGTTC
AACGAGACGAAGATGGGCTTGCTGCCATCCTAGGCGCAGGTATAACTCTGAGAGAACACCAAGATGCAATTGCGGAATCACTCATTCCGGCCAGATGCGC
ATTAAAACATCCCCGGTGATCAGCATTGAGATGCTCGAGGAAGATTATTCCGGAGTAATCCTGAGTTTCGATGGTGCAGCCAAGACATCGACAAGGCAAG
GAAGCTGTGGTTGCGTATTATTGCAACTCGCTGAATGGAGAGTTCTTGACGCTCGAGGGTACATCCTGGATGGCGTCACCGTGAACGATGCGGAATATTT
TGGATTGTTACGTGGGTGATCTATGGCCCGCGACAGAGGTGTTCAGGATCTCGTCGTCGTAGGAGACTCGAGGATCGTCATTCAACAAATCCAAGGTTTG
ATCAACTACAGCCAAAACAACCTTCAGAGGAGATTGGCCGAATGCGAAGTGCTGAAAAAGAGGTTCAACAGTGTGCGTCTGGTACATGTTAAAAGAGAAA
TCAACTAGGCTGCCGAATATCTGACCTCTAGCGTTCGCGTTAGACAACTCCTGGGTGGTTGATGAGGAGAGGGAACACCTGGAAATTGTGTCACGGATCC
GAGAACAGCTCGTGAAGACACCAGAAGTGGTGAGTAACACAACGCAGAAAGAGACGCGAACGTCGTGACCATAGGGTTTTCCAGAAGCGTCAATGTTCAA
GATCTAGCGAGTGAGCCGCTTCCGTTACCAGGACGTGTACTAGCCTCGTTCACACGAGCGAGAGCTCGAGCAAGGGATGAGGAAACCTCTCCCCCCATGG
GGCCTCTCGAATATCAGGCCGAACGGCGGAGACAGATCAAGGTGCACTAGGGAGGGGGCCAGTATCTATCGGATATCATTGCCTTCCTGAAACACGATCT
AGACCGTTTCTCACCAAGGTTTCTCAAGAAGATCGCGAATGTTGCTGATTTGTTTACTGGATGTTCGAGAAATGCTGTATCGACTTGTACGATCGAACAG
AGGTCGCCCACGCGACGTTGGAAATGAGCTCAGGTTGGTGGCTCCCGAATCTCTCCGAGAAGACATGTTGCACTACGCACATGAAGACTTTCAGAGTGGC
CATCAACGTACTCACGAGAGATTACGCTCAGAGTTCTACTGGCCAAGCATGTATGCTGACGTCGAACGATTCGTGAAGGAATGTGTCGATTTTGCCAGCG
GTAAGGGTTACCCCCGAACGCCAGATCTTCATCTGGGAATATCGAGCAATCACGACCATTCGAGGCCGTCTCGATGGATTTTGCGACCCATCTACCGGAA
TCAGTCCGAGGTAATACGTTCTTATTGCTGTTCCAAGATATGTTTTCGGAATATGTGATGTGTATGCATGTCTGCAACTGTCCCGGATGTCACTGAAGCT
TACGAAGAATCTGTCTTTCACCGATTTGGAGCATCCTCGGTAATCCGGCATGACCAGGATCCTCGCTTCATGCGCGAAGTCTTTACAAGGTTCTGAGATC
TCATAAGGAGCAATCGAAGAGCGACTCTCGTGTTCCAACCACAGGCAAACGGTCAACAAGAACGTTCAGTACAGATGGTCATTCGGAGTGTTAAGGCGTA
TATTGCGGAAGCTCTGGGATGAACACGCATAAAGGCTGATGTTCGCCCTGAATACGTCTTTCAAAGCGACTCGCCTAGACACCCCGTTCTATCTCTCGTC
CATGGGTGGGACCCTCAAGAAACTGTGTCTGCAATGCTAGAACTGAAATCTTCCAGCCTTCCCGAACGTACTGTTTACGAAGTGACGGAAGTTTCAGAGG
GACTATAGCTATGCTTTAGCTTGTGCAGAAAAGCTTCAGCGAAAAGCGAAGCGTGCGCGTTCTGAAGAGCAAACTCGAAAGTGGCGTGAGTTGTCTGACC
GCCTGAAGGCAGGTTTCGAGAAGGGAGATGTTGTTTGGCTTTACATCCCGAAAGTACAACCCGGATTGGGCCCGAAACTGGCACTCATGTGGCGTGGATC
ATTCCGAATAGAAGAAATCCGAGATGATTTTCGAGTGAAGCTCAAGGTTGAGGACTCGGGATACCGAGTAAACCCTTGGGTGCACATCAGTTGACTCAAA
CCGAGGGAAATTTCTCCAAGAAGGCCCAGAGTCGAGGTCGAAGTCGAAGACGATGATGATTTGGACGCAGCGCTATTATCTTAGAAAAGTTGGAGACCTG
GCAGCGCGAATGATGAGTACGAGCTGGAGGATATACGATGGCCGAAACGAACCCGTACGTCCAAGCGATCCTGAGAATACCTCGTGAAATGGAAGGGTTT
TGAA