Description :
From Genome Similarity Track
Location :
Scaffold_726:3275- 5532
Sequence
2257 bases(100 bases per row)
CGGAACGCGAGGGTGGGTGACACCGTTTACGTAGAGCGGAGTATAGCCTGTAGAGGCATGAACAGCGTTATTCAACGCAAACTCAACAACAGGGAGCATG
GAGCTTCAACGCTTAGGCGTATCAGCGCAAATACTGAGGAAAATGTCATTAATGATGCAATTAACAAGCTCAGTTTGACCATCGGTCTGCGGATTATCCG
TTGTAAACATGTCAAACGGGTGCCGAGCACTTTGAAGATGGATTTCCAAAACTTCCCAGTGAAGTGGGGATCTCGATCAGAGACAATTGCCACTGGCAAA
CCATGTTGTCGAAACACACAGTCCATAAACAGCTTCGCTGTACCTTCGGCATCAATAGAGTCCGGCACTGCCGCTAGATGAGCCATCTTTCTCAATCGGT
CAACAAAGAACACAATGCCAGTGTTGCCTTCCGAATATTTCGGTAGGCCAAATACAAAGTCCATACTCATGGACTCCCAACACCCAGTGGGTACAGGTAG
ACCAGCCAGCGGCGCCGCCACATGTGCTGAAGGTTTCACCCGTTGACACGTTTCACACGTACGCACATAGGTGCTCACCCACTTGTATAGTTTTTGGGCC
ACCAATAAGCCTAATTTTACTGAGCTATAGATCTTCTCACGACCGAGATGACCACTTAAAGCGGTATCATCTGCCTCATAGAAGATTCGATACTTCAACT
CTTCATCATGAGGGACAGCGATACGAGGGTTATCCATAATATCTGTGCGATAGCACAACAGACCATTATCGATAGAATATCGATGTATCCTCGCACGTAA
ACGTGCCGAAAATTCTATGTCCCAGTCTTTGAACTCCTCCCTCCCAAGAGCATGTAGCAAAGCTACACATTATTCATCCTTGGCATCAGCCGCACGGATA
AAGTCAGCGACTGACGATAACACCGTAGTGACGTGAGCAAGTTCATAGTCAGGTCGGCGCGATAGCGCATCAGCCAAAGAATTTTGCTTTCTTGACTTAT
ACTTCACTTCGAAGTTATATTCGGCAAAGAATGAGAGCCAACGAGCCATTTTCTGAGAGAGATGCGGCGACTGTGTCTCAGTGCGCAATGATGCATTATC
TGTATAGATCACAAATGGCTTTGAGCCAAGCAGATATACTCTGAATTTGACTAGAGCGTACTTCATAGCAAGTAGCTCTTTGTCATGAACTGGATAGCTC
TTTTCAGCAGCTTTGAGCTGTCGAGATTCGAATGCAATGACACTTTTGCGTCCATCGACATCAGTTTGTAACAGAGCACTGCCTGTGGTAAAGTCATATG
CGACATAGAAGACACTCAAAGGCCGATCAGGATCGTACAAAGCCAGTATTGGCGCATGAAGGAGACTTTCCTTAACTGCTTGAAAAGCATCATGTTTGGT
GTTACCCCAACACCAATCCACATCCTTTTTAAGGAGATTGGATAATGGCCGAGCCATATCTGCGTAATTCGCACTATACTTATGCAAGTAATCGGCAAGG
CCAATCCACTTACCTAGATCTTTTTGGTTCTTTGGAACCGGCCAATCGACTATGGCCCTTATCTTAGCGGGGTCCGCTCGAAGGCCTCTCTTCCCAATGA
AGCACCTCAGAAAAGGAATCTCTTCTGCATTTGCATACAATATATTTGTGCGCATGCACTCGAGCACCGCTCGTAAGTGATCAATGTGATTATCCACATC
AGAACGACCGTTCGTTGCATAACTATGGACAAAGATGTCATCAAAATACGTTTGCACATAGCCTCGATGAGGTCTGAATAGTTGCGTCACCAGACGATTA
AAACAGCCGGGGCATTTGACAACCCTTGTGGCATAACGAGCCACTCCCAGAGCATACCGCTCGGGGTACTAACCGCTGTTAGCGGAATATCGCTTGCTCG
CATGAGCAGCTGGTAATAACCATCGACTAAGTCGAGCGCACTGTACAATGTACATCCCACCATATTGTTCTGAAGAACATCCTTTCTGGGGATTGGTATC
TGAGCCGGGATAGTGGCTGCATTGAACTTATTATAAGCGTGCACAATACGCCACTTACCATTAGGCTTTTTGAAACCAAATGTAGGTGTGGAATGGGGAG
ACTTACTCTCCCGCACCATTCCCGCCGCGTGCTTAGCACGTAAGAAATCGTCAATGACGTCACACTGTTCCGTAGGTAAAGGCCACTGCCGTGTTACGCA
GTATTTAGTTCCTGAAACTAGGTCAATTTCATGACGTACACCTCTATCGGAAGGTAA