Description :
From Genome Similarity Track
Location :
Scaffold_7:32746- 33922
Transcript NameFunction/comments
Phyta_totarag498hypothetical protein

Sequence
1176 bases(100 bases per row)
TTTCTCGTCGTCTTTTCCTCCCGTAAGCACCACAGTGTGGTAAaatcctgcagcaacaagagccACTCGCTTTCCGACGAAATCATCGATAGGGAAAGGA
TACACTCGTTCATTTGTGTCTCCCGTCCCCAGTTGTCCATGATTGTTTCGACCAAAGACGTACATCACTCCGTTGTCCGATACGGCGATCGTGTGGTAAC
AGCCACACGCCAAGCGAACGATGTCTTTGCCTTCCAACTCCTCAATCAATCTGGCGTACGAaaaacgctgctgctgaagctgaagattGGTACTTGAGCT
TGCAGTGGACCGACATAGACCTAACTGGCCGTAGTCGTTACGACCAAACGCGAACAAATGCGCTCCGCTACAGAGGACGATTGAGTGGTAATAGCCGCAA
CGAATCTCCAGACactcctgcttctccaatCCAGCTCTTACTTGCACTGGAACCAAGTGGTTCTCCATTGAATCAACTCCTAGCTGGCCATAGTCATTTT
TGCCAAACGCGAACGCCTTACCTGTAGCTGTCACTACCATTGTGTGGTACTGTCCACAAGCGACAGACACTACGTGCTGGTCACTCAACGCTTCAACATA
TTGAGGAACCTTGCGATCGATAGAGTCGTTGTGTCCCAACTGTCCATAGTCATTTCGCCCAAAGGTGTACAAGTACTGCTGGCCACCACCGTCCTCTTCA
CACGCCATGACGGTGTGGTAATAACTGCACGACACCAGTCGTACGATCTTGTTCTCCAGACTCCGGACAATCTTCGGCACACTCTCACTCGCAGTATTCC
CATGGCCGAGTTGGCCGCGATAGTTGTAGCCGCAGGTTGCTGCCCGTCCAGCCATCGTAACCAAGATTGTGTGTTCACACCCGTTGTAGGCGTGGACTTG
CGAAATTCTGTTCTCCCCCAGCTTTGGGATCTCACTAAAGTGACTCACGCGAGCTGTCCCTCCTTGACCACACTGGCCATTGTCGTTATACCCACAAGTG
AGGACTTTTCCATCGGCTGTCAACGCTATGGTGTGCTCATTGCCAGCGCCAATCTGGACGATGTCTTTCTGCTGAAGTGACTCGACCCTTTCGAACGATT
TGCGAGTGGCAGTGTCTCCATGTCCGAGCTCTCCATAAGAATTCTGTCCACAACTCCACActtctcgatctccgtc