Description :
From Genome Similarity Track
Location :
Scaffold_282:3274- 5295
Sequence
2021 bases(100 bases per row)
CGTGCCAAACGCAAACTGCCGCGAGTCAAAGTCAATCTCGGGCGCCAGGAATTCAAAATCCTCGTCGTCCTCGCCATCGAAGTAGTCTCGAATGATGCGA
ACTGCTTTCTCGTAGAGCTCTGGTGTTTTCGCAAAGCAAGAAATTACACACAGTGCGCGTCAGTCGGTCAATCGTCCACCAGATAACTCTGTAGAAGCTC
ACACAATACCTTCTTCCTGGTGGTACTGGAGGCTCTGCAGGAGATCGAGTCCCTCCGCCTCTTCAACGTGCAGCGCCATCTTGTTGTCGCCGTCGATCGT
GCGCTCGGCCTCACCCAAACGCAAGATGTTCTCTAATGCGTCCAGACACACGTTGATCACCTGCGCGTCCTGCGAGTCCAGCAGCTTCACCAATGGAGGG
ATGCATCCTGCGGACATTATCAAAAGACACACGTTAGCCTCGCCCCAATATCAGCCAACCAGAGCAGCACAAGCACCATACCTTCGCGGACTAAATATTT
GATCTGGTCGGGGGATCCGCCCGAGGTCGCGTTCGAAATGGCCCACGCGGCCTCTTTCTTCACTTCAAACTCCACGGTCGAGAGCTGAAAGAGCAGCGGC
GCAATGATGCCTGCGTCGATAACCTCTTGGATCTGGCTTGGCGTGCCGGCGGTGATGTTAGAGATCGCCCAGCACGCCTCTTTCCGGATGAGCTTCTTCG
GGTGTCTAAGCAGTGGCACGAGTCGCGGGAGGATGCTGAGGTTTAGAATCGCTTGCGTCTGATGCTCATCGCCTGTGACAATGTTGCCCACGGTGCGCAG
CGCCGGTGTCTGGATCGACGTGAGGTTGTGGCCAATGAGCTCCACAATTTTGCTGCACACACCGGCATCAATCACGGCCTGAATGCATTCGGAGCGACCG
TCCGAGAGGTACGACAGTGTCCAGCAGGCGTCGGTCGCGACCTCTTCGTCGGGCGAGTGGATCAAATGCGGCAAGAGCATCAGTGCGGGGCTCACGAGGT
TGAAGTCTGGCTTGGGCTTGCCGCGGCAGAAATTGGAGAGCGCCCAGGTCGCGTTGCGCAGGATGCTCATCTTGCCCGAGCTCCGTCGCAGCACGGCCAG
CAGTGGCATCATTGCGCCCGAATTCAGCACCAAGTCGCGACACTGCGGCGAGTCGCCTGAGATGTTGCCGAGTGCCCACACGGCCTGCTCGCACACGTCT
TCATTCGAAGAGAGCAGCAGCTCGCAGAGCACGGGCACGGCGCCGCACGAGATCACCACCTCCGTGTTGTCCGACGTGCCCGACGCGATGTTCGTGAGCG
TCCAGGCAGACTCGAATTGAAGCTCGGGCTTGTCGTGCATGCGCAAAAAGTTCACGAGCAGCGGCACGACGCCCAGGTTGATCACTTCCTGGATCGGCGG
ATTGTTTTCTATCGTGTGTAAACATATAGACACGATGTTATTGAGGTATACATGGTAGTTAACAAACATAGAAAGAGCTGCTTGATGTCACGTACCAAGT
GAGAGCAGGCGACGCAGCTTGGCGACCGCCGTGGTCTGCTTCATCGGGTCCAGCGACTGGATCATCGCGGCGATTTTCGGCAGGTCCTGGATCTAAACAC
CCATAGCAAAACGCAATAGCACCATACCAGCACGTAGGTTAGCACCGGTCAATACGTAGTAAATCTCCATGTAATGGCCTGTGCACGTACACCGACGCCG
CTCGGCGGCACGCCCGAGAACTTGCCCGCAATGACGTCTCCGCCTTCGTCGTCGGTCGCATCGAGCTCCGCCTGTTGAAGACAAGTCACATAGTGTGCAG
CCATCAAGTATGTGAGCCACTGCGTTGAGATAAACACTCACATAACAGAGTGAGCGAGAAGACGCAAGAGCAAGTGAAAATGGTACCATGGTGTCCATGA
TGCGCCGCCGCTGGTTGAGCCGGTCCTCCTTGATGGTCTTGCGGATCTGCACGGTCGTGCCCTCGCGGCGGCGGCGCGTCACGTCTGCGTCGATGCCTTT
CTTGAAGCTGCGCTGGCGCTC