Description :
From Genome Similarity Track
Location :
Scaffold_152:32738- 34304
Sequence
1566 bases(100 bases per row)
AAGACAACCGCGACTTCCGGGACAGTCGGCTAGTAGCAAAGGCTGTAAAAGCTCGGTAAGCACTTCAACCtaaagcagcagccaaactcGCAATAGCCAA
CTGCAATTCAGGAAACTTTCACAGTTGCATATTGCAATCTGCCGCGATCGTACAATTGGAAATTGTATTCCAACACCTCTCGCAGTAAGGAATTGCAgta
aaatattttgtacgGCAGGTAAACCAAGATTATTTTTCGGCCCCTACTTCTGACAAATACTAGGTCGTCTGCGACCTACGTTGAGAATaccttttttttt
tttaaggGAAACTAATAAGATACCTGTCATAGTTTTCAAAATGAATAAAATGACCCTCATAGTTTCAAAACAAATAAAAATTCCCTCGCCGACGGGTCCT
TTATTCATAAAATGCCCCCCGCCAAAGAAAGTATTTACCGAGTCAAGTGACAGCTCGAGATGAACAATATCGAGACACGCATTGCCAAAACGATTATTGG
TTAGTTGGAACTGGAGCCGTTGCACTTGCGCTTGCTGTGACCAGCTACACCACAGATCGAACAACGCAAGGGACGGCTGGTCCTTTTCCTGGCGTTCTCC
ATTAAGCTCTTTCAGAACATAGTCCCTTGCGGTCATACACACCTCGAATGAACTAAACACTCCATGCTCTCGACTTACACCAGGGTCATCACGCAGCTTA
GACTGGAAAATGGTGGCGACTGCTCGAAATTTAAAGCTCGACTGCGATACCACACCAGGTGCACAAGTACACTCTGACTGCATCGTGCGTACACTTCACA
CGCCATCTTTGCAAGCTCCACGCAACGTGGATATACCATGGCCCACGGTGCTGGCTGTCATGGCGGTCATCCCGGTAatctccatcgtcgtggCCATCTT
GGTGGCTATGCTGGACTACTGGCTCGGCGCGGACGGTGTGAAATACGAAAAAACATTTTCATTGAAAATACGTCGCCTGTTGCAGTCTCGTGGCGTTTAC
TCAGCGAAGGCTTACCAGCAGGATTTCTAATATTCCCGGTCGCTGGAGTTGGTGAAGAGATGCATCCATACGGCGGAATAGCGTAACTGTTTCCAGCAAG
CTTCAAACGAGAACCCAGGCACAGTTGTTCTTCTCTTGATCAGTGCATACACCAAGTTGTTCTTATCTCTTTTCAGAGCCTTCAGGTCGAACCCCCCTCG
GCCAATGGCGACGAAGAGTGTGGAAATAAGATTTTGCTTAGACGCGAAGGTCTGTCCGACAGTGAGGAACGAGGTGTCGGATGAGAGATTGGAGGATCTA
CCAGGTGCTCGAAGTTGGCCATAGATTAATAGTGTGCTCCACGTCTCGCCGGCACATGTAACTAGCGTTTACAGCATGTGCGAGCTCGGAATCGACTGTA
ACCTCACAAAAACGTATAAAAACCGAGCTACTGTGCAAAGCACATACCCCAATAAAACCTATCCAAGCTCTCTGCAGCTCCAAACTCCCAGTTTCCACCA
CTATTGAAGGTGTAGTCCGATAACTGTTAATGCGGATTTCAACCAGGCGGTCGTGTCAGGACCACC