Description :
From Genome Similarity Track
Location :
contig_40:327338- 331516
Transcript NameFunction/comments
g8679.t1hypothetical protein
g8680.t1hypothetical protein

Sequence
4178 bases(100 bases per row)
TCCGTTGGCCCAGAGAGTTTGTACAACTGGATGGTGAGTGAGCCGAAGAAGCGAATGGCATCCTGTGACATTGGTGTCATTGACACTGCGAAGGAAATTG
GCCGTAATATTACGCATTTGGTCATCTATCTCGGTAAAATACCGCAACCAATCGAAAAGATACAGCATACAAACGCCAAGTTATTCGACGCCCCCTCGCT
TGCACGAAATCATTCCGGAAGACTAACGTGGGGACACTCCCCGAAGCAAAGAGCTCCCAACTGCAGGCCCCAGAGAAGCGAGCCACGATGGACCGCCTCG
CGATCGACAAGCTTAAGAACGTCATGGACGAAGCGTACGTCCCCTCACCCCCCTCTCTCCCCTGCGAGTTATTGGCACAGTTCTGCTGACGTAGATCTTC
CTTGTGCTCTCTATCTGTAGGAAGAGCGCCGTGAAGGCCAAGATGGGAACCGACGTGGAGCGCAAGATGGAGGAGGCGCTGTCCAACAAGAACTGGGGCG
TCCAGCACGCTGCTCAACGAGATCTCGCAGCTCACCTACGACTAGTGCGCAGCGTTCGATGTTCACAATTTGCTACTGTGCTGGTATACTCATGTAGTGT
TGCTGCTCTTGAATTGTAGCGAGGCGTACGGCGTCGTCATGCGCAAGATCTGGGAGGCGCTGGACGCCGAGGGACGCCAGTGGCGTGCCGTGTACAAGGC
GCTGAGTCTGCTGGAGCACCTGATCAAGAACGGCACGGAGCGCGTGATCGAGAACGCACGCGACCACATGTTCAAGCTGCGCCACCTCTCGGGCTTCTCG
TACCACGATGGAGCTGTGGACAGGGGCAATGGAGGTGGGAACCTTAAGATTTTGGGCTGCAAGAGCCTAGAGTTGCTGACTTTTTTGTTGCAGTCCGGGA
CAAGGCCAAGCAGTTGGTGGACATGCTGAACGACAACGAGATGATCCGCACGGAGCGCGAGAAGGCGGGACGTCTTCGCAACAAGTATGTAGGCATTGGA
AGCGGCGTTGGCGGTGGAATGGGCGGCGGCTATAGTGGCAGTAACAGCTACAGCGGAGGAGGTGGGGTGGCTACAGTGGAGGAGGTGGCTACAGTGGTGG
TGGTGGTAGCGGCGGTGGTAGCAACAGCTACAGTGGTGGTGGTGGTGGCGGCGGTGGCAGTAGCTACAGTGGTGGTGGCAGCACGAGCTACAGCGGCGGT
GGTGGTTTAGTGGCGGTGGCAGCAGAGGCTACGGCGACAATGACTCGAAAAACTACCAGGAGAAGGAGAAGGGCTACTCGAGCCGCTACGCTGATGACGA
CCGCGGTGAGTAGCCACAAAAATGACGCTATTGAATGAACCACTAACGTAGAACTCTCTTCCTAACAGATGACGGAAGCGAAGAATCTGAATCGGAGGAG
GAAGTGCGCTCCAAGCGACGGACAGCGTCATCTAAGCGTAAGGCTGCGGCGAAGAAGAAAGAGGTACTCGGGAGTGCATTTCTTGTTGGGTTGTGTAATT
TATACCAAACCTAAACTGGTCGATTTTGAATTTACAGGAAACCGAAGCCAAGCCAGCTACGAAGACACCCTCCGCGCAGCCGTCCCTCCTCGACAGTGAC
TTCTTCAGTGCTGCTCCCGCGGCAGGTATGAATGCTTTGTTTTGTACTGATGATGGCTGCTTGATTCGGTTTACTAAAACATTGCTATAGCTTCTCCTGC
AGTGAATACATTGACCCCTTCGCACCAGCACCTGCGGCCCCCGCGGCTGCACCTCAAGCGGCTTCATTTGCGGCGTTTGGAAACGCTGCGACCGCACCTC
AGCAGTCGTTTAATGCTTTCGGTACGCCGCAGCCGCAGCAACAGCAAGCTTCGTTTGATGCTTTCGGAAACGCTACACCAGCCCAAGGCAACGCTCAACA
GTTCGCTGCATTCCCCGCTGCGCCAGCTCAGCACGGCTTCAATGCCTTCGGCCAGCAAGGTAACGCCGCTGCTCCTCCCGCTCCTGCTTTCAACCAGCAA
CAGCAGTTTGGCCAGTTCGGTGGCATGCAAGGAGGCATGCAGCAGCCTATGCAGGGTGGTATGCAGAGTGGTATGGGCATGCAGGGTGCTCAAAGCCGAA
CGTCTTCCAATCCTGGTGCCAACCAGGCACGAACGAACTCGGGTCCGAAGCCGGATGAAAAGAAGAACAACGATGCGTGGGGTGCTGGCTCGTCGCTATT
TGATCTCAACAATTTGTCCAGTTCTACCGGAAGCAACGCAAGTAATGCAGGCCGTCCTGGTCAGCAGCAACAGCAGCAGCAGCAGCAGCAGTCCAATGCG
GGCCGCAACAGCTTCAGTGGCCTGGACACTCTTGCTGGGATGCCCAGCAAGCCGATGGCGGTGGCGGTGGCATGAACCCTATGGGCATGGGTGGAATGAA
CTACGGCGGCGGCATGGGCCAGGGTGGCATGCAGCAGCCCGGAGGCATGGCGTACGGACAAATGCAGATGGGTGCCATGGGCGGAATGCAGCCCCGCCCC
ATGATGGGGGGTATGGGCATGCAGCAGCCAGGCATGGGTATGCAGCAGCCTGGCATGGGAGGCATGATGAACCAGGGTGGTTTTGGCGGCATGAATGTGA
TGCAGCAGCAGCAACAACAGCAGCAGCAGCAACAGCAGCAGCAACAGCAGCAGCAACGACAGCAGCAGCAGGCGTTCGGCTCATTTGGCAACTTTAGCTG
AAGAGAACTGGTTGGCGCTACAGTCTCGACGCAAGAAGACGAGCAGGTGTCAAGTTTGCCGATAATACATGGTAAACACGGGTGTGGCAAGTTGATGCCT
ACCGTCCAAACAACTAGACGAAGAGACTTCAACTGCTAAGAAGAAGCCGCAGTGCTTCTGCAGAATGGATGATATACGTGTGCGAGAGCTGCAGCGTCAA
CAGTCCGAGCATGTTGTTTGCCACTTTTTCGTGCGCTTTGAGTTGTATCCAAAACGCCTCAATTGAAAGCCTTCTCACCACTGCAGTGACTGATGACACG
ATGCAGCGGTGAGAGGTGGTAATGGAGGAGACATGTATGCACACTTGCACTAGCACTAACAGCTCCCTCCTCATGTCTTCCTCAAAAAGATGCAACACTC
GATAGCATCTTTGTCGAACTCTGCGAGCCGCGCGAACTACCGCATTCGTCAGCGGTAAAATCTTGTCGCTGTACCTCCAGCAACAACAGCCTGGGAGGAA
GTGACGCATTCCAGCTACTCGCCACACTGTACGTTGTCCAGCTCGCTCAGCGTCGTTAGCTACATAGCCAGCTGGGCCAGTATCTAGTCGAAAAAGAAGT
TCCTTTGCTCCTTCAAGAACACGCCGAAAGTCGCCCATGCTTGTTTCCAAACAGTGCGTTCTGCGGGGACTGCGGCTGCGTCGTACAAGCGTCCTCCATC
TCCTGGTCCTGCTCGAGTCTCTGTCTAGCTGAATGTCTGGAACAAATCTCCACTGGCACTACTACTCCGTGACAATTTGCCCGAGGACGTGGCCAAGATG
TTGATCTGACTCGACGTTTTCTTGAGACTCACGCGCTGCTCGTCTCCGTCCTCTGCTGTGTCCACGTGGACCGATTTCCGTTTCCTCAGTCCTTCCGGGT
ACTTGTTGAGCACACTAAAAGGCGACATGACGCGTAAATGTCCAGGTATCGACAGTCTAGCGGGAGGACTTCGTTTCTGGCCTCTGGCGAACGCACTTGG
AGGCGGAGAGTGGACGGCATTGTCCTCCTCCATGGGCGTGATCTCCACCTCGTCCACACTCACCATGGTCTCGAGTCCTCCGTCGTCGTCCTCGGAACTG
GCTCTTCTCTGTATCCTGGTGCTCGCCGCCTGCTGCTTGCGCCTCAGCTGCTTCCTCAACACGTCGCGTGGTTGCGGAGACGACGGCGGCGTGCTCGGGC
GCTCGGGCGGGAGCAGCTGCAGCACCTTAAAGTGTTCGTTGGTGGCTCCACTGCTGCGTCTGTCGGCCTCCGCCTCCTCCGCGGCGGCTGTCGTCGTATC
GTGGTGACGCCCCACGGCGATGCGCGTGAGCTTCTCGCGCAGTAAGACCATGTCTTCGTGGTCGCTGACGAGCGAGTTGCGTCGCAACTTGGAGTTGATG
TTCACGGCGGCGTCGGGCGTCAGCGCGCGGCTCTTGGGGCACAGGTTGGGGCTGGACGGAGACATCATGGCGGGGAGA