Description :
From Genome Similarity Track
Location :
contig_40:327324- 331502
Transcript NameFunction/comments
g9079.t1hypothetical protein
g9080.t1XP_009524046.1 hypothetical protein PHYSODRAFT_495040 [Phytophthora sojae

Sequence
4178 bases(100 bases per row)
TCCGTTGGCCCAGAGAGTTTGTACAACTGGATGGTGAGTGAGCCGAAGAAGCGAATGGCATCCTGTGACATTGGTGTCATTGACACTGCGAAGGAAATTG
GCCGTAATATTACGCATTTGGTCATCTATCTCGGTAAAATACCGCAACCAATCGAAAAGATACAGCATACAAACGCCAAGTTATTCGACGCCCCCTCGCT
TGCACGAAATCATTCCGGAAGACTAACGTGGGGACACTCCCCGAAGCAAAGAGCTCCCGACTGCAGGCCCCAGAGAAGCGAGCCACGATGGACCGCCTCG
CGATCGACAAGCTTAAGAACGTCATGGACGAAGCGTACGTCCCCTCACCCCCCTCTCTCCCCTGCGAGTTATTGGCACAGTTCTGCTGACGTAGATCTTC
CTTGTGCTCTCTATCTGTAGGAAGAGCGCCGTGAAGGCCAAGATGGGAACCGACGTGGAGCGCAAGATGGAGGAGGCGCTGTCCAACAAGAACTGGGGCG
TCCAGCACGCTGCTCAACGAGATCTCGCAGCTCACCTACGACTAGTGCGCAGCGTTCGATGTTCACAATTTGCTACTGTGCTGGTATACTCATGTAGTGT
TGCTGCTCTTGAATTGTAGCGAGGCGTACGGCGTCGTCATGCGCAAGATCTGGGAGGCGCTGGACGCCGAGGGACGCCAGTGGCGTGCCGTGTACAAGGC
GCTGAGTCTGCTGGAGCACCTGATCAAGAACGGCACGGAGCGCGTGATCGAGAACGCACGCGACCACATGTTCAAGCTGCGCCACCTCTCGGGCTTCTCG
TACCACGATGGAGCTGTGGACAGGGGCAATGGAGGTGGGAACCTTAAGATTTTGGGCTGCAAGAGCCTAGAGTTGCTGACTTTTTTGTTGCAGTCCGGGA
CAAGGCCAAGCAGTTGGTGGACATGCTGAACGACAACGAGATGATCCGCACGGAGCGCGAGAAGGCGGGACGTCTTCGCAACAAGTATGTAGGCATTGGA
AGCGGCGTTGGCGGTGGAATGGGCGGCGGCTATAGTGGCAGTAACAGCTACAGCGGAGGAGGTGGGGTGGCTACAGTGGAGGAGGTGGCTACAGTGGTGG
TGGTGGTAGCGGCGGTGGTAGCAACAGCTACAGTGGTGGTGGTGGTGGCGGCGGTGGCAGTAGCTACAGTGGTGGTGGCAGCACGAGCTACAGCGGCGGT
GGTGGTTTAGTGGCGGTGGCAGCAGAGGCTACGGCGACAATGACTCGAAAAACTACCAGGAGAAGGAGAAGGGCTACTCGAGCCGCTACGCTGATGACGA
CCGCGGTGAGTAGCCACAAAAATGACGCTATTGAATGAACCACTAACGTAGAACTCTCTTCCTAACAGATGACGGAAGCGAAGAATCTGAATCGGAGGAG
GAAGTGCGCTCCAAGCGACGGACAGCGTCATCTAAGCGTAAGGCTGCGGCGAAGAAGAAAGAGGTACTCGGGAGTGCATTTCTTGTTGGGTTGTGTAATT
TATACCAAACCTAAACTGGTCGATTTTGAATTTACAGGAAACCGAAGCCAAGCCAGCTACGAAGACACCCTCCGCGCAGCCGTCCCTCCTCGACAGTGAC
TTCTTCAGTGCTGCTCCCGCGGCAGGTATGAATGCTTTGTTTTGTACTGATGATGGCAGCTTGATTCGGTTTACTAAAACATTGCTATAGCTTCTCCTGC
AGTGAATACATTGACCCCTTCGCACCAGCACCTGCGGCCCCCGCGGCTGCACCTCAAGCGGCTTCATTTGCGGCGTTTGGAAACGCTGCGACCGCACCTC
AGCAGTCGTTTAATGCTTTCGGTACGCCGCAGCCGCAGCAACAGCAAGCTTCGTTTGATGCTTTCGGAAACGCTACACCAGCCCAAGGCAACGCTCAACA
GTTCGCTGCATTCCCCGCTGCGCCAGCTCAGCACGGCTTCAATGCCTTCGGCCAGCAAGGTAACGCCGCTGCTCCTCCCGCTCCTGCTTTCAACCAGCAA
CAGCAGTTTGGCCAGTTCGGTGGCATGCAAGGAGGCATGCAGCAGCCTATGCAGGGTGGTATGCAGAGTGGTATGGGCATGCAGGGTGCTCAAAGCCGAA
CGTCTTCCAATCCTGGTGCCAACCAGGCACGAACGAACTCGGGTCCGAAGCCGGATGAAAAGAAGAACAACGATGCGTGGGGTGCTGGCTCGTCGCTATT
TGATCTCAACAATTTGTCCAGTTCTACCGGAAGCAACGCAAGTAATGCAGGCCGTCCTGGTCAGCAGCAACAGCAGCAGCAGCAGCATCAGTCCAATGCG
GGCCGCAACAGCTTCAGTGGCCTGGACACTCTTGCTGGGATGCCCAGCAAGCCGATGGCGGTGGCGGTGGCATGAACCCTATGGGCATGGGTGGAATGAA
CTACGGCGGCGGCATGGGCCAGGGTGGCATGCAGCAGCCCGGAGGCATGGCGTACGGACAAATGCAGATGGGTGCCATGGGCGGAATGCAGCCCCGCCCC
ATGATGGGGGGTATGGGCATGCAGCAGCCAGGCATGGGTATGCAGCAGCCTGGCATGGGAGGCATGATGAACCAGGGTGGTTTTGGCGGCATGAATGTGA
TGCAGCAGCAGCAACAACAGCAGCAGCAGCAACAGCAGCAGCAACAGCAGCAGCAACGACAGCAGCAGCAGGCGTTCGGCTCATTTGGCAACTTTAGCTG
AAGAGAACTGGTTGGCGCTACAGTCTCGACGCAAGAAGACGAGCAGGTGTCAAGTTTGCCGATAATACATGGTAAACACGGGTGTGGCAAGTTGATGCCT
ACCGTCCAAACAACTAGACGAAGAGACTTCAACTGCTAAGAAGAAGCCGCAGTGCTTCTGCAGAATGGATGATATACGTGTGCGAGAGCTGCAGCGTCAA
CAGTCCGAGCATGTTGTTTGCCACTTTTTCGTGCGCTTTGAGTTGTATCCAAAACGCCTCAATTGAAAGCCTTCTCACCACTGCAGTGACTGATGACACG
ATGCAGCGGTGAGAGGTGGTAATGGAGGAGACATGTATGCACACTTGCACTAGCACTAACAGCTCCCTCCTCATGTCTTCCTCAAAAAGATGCAACACTC
GATAGCATCTTTGTCGAACTCTGCGAGCCGCGCGAACTACCGCATTCGTCAGCGGTAAAATCTTGTCGCTGTACCTCCAGCAACAACAGCCTGGGAGGAA
GTGACGCATTCCAGCTACTCGCCACACTGTACGTTGTCCAGCTCGCTCAGCGTCGTTAGCTACATAGCCAGCTGGGCCAGTATCTAGTCGAAAAAGAAGT
TCCTTTGCTCCTTCAAGAACACGCCGAAAGTCGCCCATGCTTGTTTCCAAACAGTGCGTTCTGCGGGGACTGCGGCTGCGTCGTACAAGCGTCCTCCATC
TCCTGGTCCTGCTCGAGTCTCTGTCTAGCTGAATGTCTGGAACAAATCTCCACTGGCACTACTACTCCGTGACAATTTGCCCGAGGACGTGGCCAAGATG
TTGATCTGACTCGACGTTTTCTTGAGACTCACGCGCTGCTCGTCTCCGTCCTCTGCTGTGTCCACGTGGACCGATTTCCGTTTCCTCAGTCCTTCCGGGT
ACTTGTTGAGCACACTAAAAGGCGACATGACGCGTAAATGTCCAGGTATCGACAGTCTAGCGGGAGGACTTCGTTTCTGGCCTCTGGCGAACGCACTTGG
AGGCGGAGAGTGGACGGCATTGTCCTCCTCCATGGGCGTGATCTCCACCTCGTCCACACTCACCATGGTCTCGAGTCCTCCGTCGTCGCCCTCGGAACTG
GCTCTTCTCTGTATCCTGGTGCTCGCCGCCTGCTGCTTGCGCCTCAGCTGCTTCCTCAACACGTCGCGTGGCTGCGGAGACGACGGCGGCGTGCTCGGGC
GCTCGGGCGGGAGCAGCTGCAGCACCTTAAAGTGTTCGTTGGTGGCTCCACTGCTGCGTCTGTCGGCCTCCGCCTCCTCCGCGGCGGCTGTCGTCGCATC
GTGGTGACGCCCCACGGCGATGCGCGTGAGCTTCTCGCGCAGCAAGACCATGTCTTCGTGGTCGCTGACGAGCGAGTTGCGGCGCAACTTGGAGTTGATG
TTCACGGCGGCGTCGGGCGTCAGCGCGCGGCTCTTGGGGCACAGGTTGGGGCTGGACGGAGACATCATGGCGGGGAGA