Description :
From Genome Similarity Track
Location :
Scaffold_1726:3273- 4745
Transcript NameFunction/comments
Phypl_g14037hypothetical protein

Sequence
1472 bases(100 bases per row)
GGCTTCCCATGCGAGTTCAGGGATGAGCTGATTCGTATTGCGTTGCGATTCGATTTGTGGAGAGTGGGTTTAGGCGCGGACCCGCCTGCTCGAGTGCCGC
CAATGCGGATACGACTCAAGAAGGGTGCGAAGCCGTACAGATGCAAGGCTCGTAAGTACCCGCCAGAGGCTCGTCGCTTCTTGGACGATTTTAACAAGAA
ATTTGTGGAGCTAGGTTGGGTGCATGAAAACCAAGGGAGTAGATGGGCCTGCCCCGCTCTTCCGGTGTGCAAAGGACAAGGAGAATTCCGACAGACTGCC
GATTACAAGCCCATGAACGCAATGGTCGAGGCGATTGTGGGGGTGATGCCTGACCTACATACCGGCCTCGAAGATGTAAAGGGCGCCGTTTACTTCGGAT
TATTCGACTTCATTAAAATATATTGGCAGCTCGCCTTGGCAGATGAGTGCTAAGAGATGCTGTCATATATGACCCACACCAAAGTTTACACGCCGAAGCG
TTCCCCAGGGCTACACCGATGCCGCAATGTTCTTCCAAGCTACAATACATAAATGTTTGGAAGAGTTGTTGCACAAGCATTTGCTGGTGTGGGTAGACGA
CTTGCTCCTTTTTGCTAATGACGTCGAGACCGTCTTGGCTAAGATGGAGAGACTGTTTGAACTGCTCGATTTTGTTTTGGTTTCAAGCTCAGTGTGAAGA
AGTCGTGTTTGTTTAAGCCTGAAGTGCGTTAGTGTGGGGAAATTATTTCGGATTCTGGAGTCCGTCATGACCCTGAGCGACTCCGGACACTCCAGGAACT
CCCATATCCCACCACGGCAGGTGACCTCCAACAATTATTATGCTCGACGAACTGGATGAGAGATAGTTTGGTTGACTACGCAAGAACGACTCGTCCTTTG
CAAGACGCTTTCGATACCGCTTTGGTCCATATAGGTAAGCGTACAAAGAGGGTAGCAGCTGGTATTGCTATTAGACTGACTAACGAACAACGGAAGGCGT
ACGATGCAGTCAAAGAGTTGTTGGCAAATAGCGTGAAGCTTGCGTTCCCACGAGAGAACGCCACCATGTGCGTAATGACAGACGCGAGCGACGTCGGTTG
GAGTTTAGTGGTGAGCCAAGTACTCGAATGGAAAGCTGACGTCCCTGTTCACGAGCAACAGCATGAGCTGCTCATATGCTTGAGTGGAACTTTCACGGGC
TCGGAGTGCCATTGGGGCATTATAGAGAAAGAAGCGTATCCAATTGTCTGTGCTTGTGACAAGTTAAGCTACTTGCTCCTACGGCCGAATGGTTTTCAGC
TTTACTATGACCACAGGAATTTGATTTACGTTTTTGCACCTGGAGTTGAAGTGAAGAAGCATATCCGCGGGAAATTGTTGCGGTGGGCAACAAAACTGAT
AGAATATAAGTACGAGATCCAACATATCGACGGCACATCGAACGTGTGGAGCGACATGGTGTCCCGTTGGGC