Description :
From Genome Similarity Track
Location :
Scaffold_209:3273- 4513
Transcript NameFunction/comments
Phyke_g6505hypothetical protein PHYSODRAFT_525772

Sequence
1240 bases(100 bases per row)
GGTGCTGATTCAGCACTAACATGAGCTGCAACTCGTGTCAATTGACCTGTACAGTACCAATACTACTGTACTATTGTTTCTGAAGTTTGACCCCGGCTCA
AGTAGTACTGGATTGAATTGGCCCGCTGTGTAACCAGTTGATACAGGCGGTCAAACCGTGGTGGATTATGCGCCTGCTGCCATCCTTTTCGATCCTTTCA
AGCTGAGCCCTACAAGGTCTAATCTGTCGCAGTCGATCACGGTGTGCCTCTGGTTCGGCTttctcactttgcaattcgCTGGACGGCAGGCAAGCCAAGG
AACCTGGTCATTCCAACTGGAGAACGCGCGATGGAGTCGCCTGGGAAATCCGACAAGCtcatccaagaagatgatgtcCTCGAGGTCGGGCATGACGGCA
TGCCACAGGAGATCTGGGACGACATGGTCCAGAACGAGCGCAAAATCTTCTACATGTTCATGTTCCTGAACGGCTCCGTGCTCTGGGCCTACTACTCGTG
TCTGAGTGCTCAAGATTTCTACGAAGTGCAGTTCGCGGATTCAGGACTGGACTTCTCGTTCTTGACGACGCTGTGTACGTCTTGGCCGATGGCTCTAGGT
CAAGGTCTGCAGATGTTCTTTGGCCTGGACAAGAAGTTCTCCCGACAGTTCCGAGTGCACGTCGGCTACGGCATTTTCATTGTGATGGCGATTCTGATCA
TGGTCTTTAGCGCCATCAATTTCTCCAACCAGAAGACCGGTGCCATCCTTGTGCTCGTGTGTTTTGGCATTGTGGGGTTCGGCAACTCTCTGACGGAGGC
CACGTACTACACGTTTGCGGCATTATTCCCGATCAACAAGTTCTCCCAGGCCGTACAGATTGGCAACGGTACCGCTGGTATCTTCAACATCACGCTGGCC
ACCGTCTTGCGTCTTGCAGTGGGTGGCGTCCACCAGACCAGCGATTCTACCAAGTTATCGTTCTACCTCTTTTTCGGCATCCTTATcgttgtgctgcttg
tggcGCTCGTTGTCTACTACCGCTTAATGAGTCTACCGTGCGTCAAGTATCTGCTGGAACGTAATGAGGAATCCTCCAAAGCTGAAAGCTTGGCCTCACA
GCCTATGGGCAAGACGTTTGGCAATCTGTGGCGCATCTTTTGTATCATCTGGGTGCCTGCATTGGCTCAgttcctcatcttcttcgtgtcgCTTACCGTG
TATCCAGGCTTcggttgtgctgctgcacgtaACCTGGAGC