Description :
From Genome Similarity Track
Location :
scaffold_147:32722- 36741
Sequence
4019 bases(100 bases per row)
AACTCCAATAAAAAGCACGGGCATTGAGATGGTTCGTGACGTTCGGTAGCGACCTCCGTCTACAACCACTTGCTTTAAAGCCGAGTAAAGCACGCAACTG
CACTCCCGAAGCACATCCACAGCGTATAACCCTTTGCAGACATCCCAAGTAGCACATCCGTTACTGTCGGTCATGACAATTTGCCGTTCCGAGCTGCAGT
TGTCGGTGATTTGGAACGGAATACCCGCCAGTTTGATGGTCAGGTGGGGGTTAAAGTAATCCACCAGTTGCAAAGAGTAAGTCCATCGAAACACATCGAG
AGGAATCACCATTTCCTGGACTGAAGAAGACGCCGTTGTGGGGCCGCTGTACAGCCCAGAGGCCGAGACAGTGGGGTAAACAGCAACTAATGACGTCCAC
TCGAAGTAGTCGAGATGGAAGACATACAGCGAATAACTGCCGGGAATTAAACGACAATTCGCTCTCCCCTCGCTGTTAGTCACAAATAATTGTCTTCGGT
CCTTGACCATTCCGGACGTATCGTCTGATGGCTTGGAGTCTTTATCTTCAAAGGTAGGAGCAATTAATTCCTGCGTCTCTTCCTTCTTACACTCTTCAAG
GTGGTCTTCTGATGCAAATTGCGTATTCTTACGGCTCCACTCTTCCAACAGAGCACGCTCATCCAGTACTGGTTTCTCCTTGAATGGAACAGCTACTCCA
CGTCTCATTAGGTCGAGTTCTGCCAGTTCTCCCCGTGTAGAATGCTGTAGTAAGTCACGTTCCGATTCGGATAGCTCCAGTCGGTTAGTAAACAGTCTTT
GCAGTCGAATCGGAACCCCTTGGGAGTACTCTCGAGCGTGTTCACTCGTTCTTGCCCTCTCAAGGATCCTTCCTTTGATTTTCTCGTAGCGAAGACGCAT
CACTCGTCTCAGTAGCGCTCTTGCTCGGACGACGGAGATGAATTTTACATTTAGATTCGCTGCGGTTATCGCTCGCTTCGAAGCTTTTTCAATGCAGTCG
GTGACAAATGCCTCCGCCACTTCTTGTGTGATTTCACTGGCTCGTTTCTTCTGCAATCGACGGCGAATCGACATCAAGCGAGAGCCCATCATGAGCGTCG
GGAGCACAGTCTTCGCCAGATTCGAGCTCAAAGCATCAAACGCGATGTTCTTCTCGATAAACACGTGGACTTTTTCAACTGGCGCGTTGGTTTGTGCACT
TACAACTCGAAACTCAACGTGCCGCTTTACCCGTTTATTCTGTGGAGCGAAAGGGTTTTGCTGGAGGCATTCCTTTATCCCATGTTGAGCGAGAATACGG
AGCAATGTACGATACACAGATTGAATCGTAGGTAGAGTTCGGTTTGCCGTGTTTCGGTGTGTGTATACGTCGATTTCCTTTTCCACTTCCTGCAACTTGA
GTGCGATTCGTAACGGGAATTTTGCCTCGTTCTCGTTCGTTGGAATCAACACGATCCGGCCATTTTTGCCAAAACGAATGTTTTTAGCTAATTGACGAGC
GAAATTTTCACATTCGCAATTTTCCACCGCGTTTTCCTTTTCGTTTCCAGTTTCGATAAAGTGGACGCGGATTTCGTACGTTTGGATAATTCTCAACTCG
GCAAGCAGCACGTTCACTTCGTCCATGCTGGCGTAAATGGATGTGGCATTCCCACACCCTCCGATAGACTGAAGCTGCCACTGGTTGTTCTTCTTGGAGC
GATAAACTGCAGCTAAAGTGAACCATCGACAATCTGCAGTGGGTTTTGCATCAAACATCCCCAAAACTTGGTGTTCTTCAGCATTTTCAATCTGGATACG
TACTGCTGGCATTTGTTTACTAAAGTTTGAATCGTTGCAGTCGTTGGCTTCGTCTTCTGAAATTTTCTGAAGGGAGAATAAAACGCAAAATATCTTGTTG
GAGAGAGCTGTAAGTCGAAGGAATAAGCGATCTACCGTGCCATTGTAAAGCGACTGGCCTTGCCGGTAGGAAATCCCTCCGCGTTTGGTAACTGGACAAC
CTTCATGAACGAAATCAACGAGTTGGAAGTCGTAGTCGACCAAAACACAGACAAAACGCCACGGTGTTCTGAGTCCGCCATTATCAAACACCATAGTTGA
TGAAACAAGCAGATTATTCATAAACGGTAGCGTGTACAAGCCCGTAGATGTTGGTGTCAGCATCGATAAACTTGGCAAATCATCCATTCGGTGGTTTTGC
GCTCGACAATAGTCATCTTGGATACGTTTAAGATAACTCACGACCTCTTGTAATTCTGCTGCAGCGAAGAAAAAGCCGATTTTCTCGAACTCAGTGGCAA
CTTTCCGCTCCGTTAACACAAGTTTTCGGTTGATCACAGACTCCATAAGTGTCCGTTCTCTGTTGTGTCTCGTTTGGCCAGCGAGTGCCAGTAAATGGCG
AAATGCCTGGATTTGAATCTCCTCTCCTGGAGAGCGCTTTGCCTCGAATAAAACGATCGATTCGATCTTCTTCTTGATGTCTTCTAGATTTGGAAAGCAA
CCAGTAGAATTCATCGAATGGAGCACCACCTCAACGGAGCTTCTGCCTGCAGCTCGGGTAAGTTCCATCGTGATCTCGAAGAAACCAGTGGGTGGGCGAG
TCTCTCCGGAATTGACCACCACAGTAAGTAAATGGCTCATTTGCTCGATCCCTGCAACAAGAGCGTTTGTCTTTTGTTCGTATTCGCTCTGTGACCGACA
AACGTGATCGTGGCTTCTTTGGACACTAAATTCCGCCGCGTACTCGATCAAAACGCAGATATCTCCTGACTGAACAGCGGTAAGCAACAAGTTCTCGAAT
GATTTTGGGTTTGCAACACCAACATCGTGATGGGCGCCGTCGAAAAAGTTTGCCAACAAGACAATTGACCCTTTTGTGGTGACTGACGCACTGGTTGATT
GAGAAACTGGAGTCCAAATTGGAGGAGCATTTACCCGCCAGAAGACAGTTCGATGTGCGTTTACAGTGTTCCCAAAATGAGAGTTGTCTTGTACGGACCC
AATTTCAGGTATCGTCAAGGATATGAGGAGCTCACCCGGTCTGCTGCAAGGTTTTCTTCCTGGTTGTTGTAGTTTCCAAAGTTTGAAAGTAGAAATCATC
CCCACAAAGCCGATTTTCGCTCGCCAATCACGGACGCTTCTCGCATAGGACGGGTGGCCCCCTACGTAAACCGAGTGGGAGTTTGGAGATGTTTGGACCC
ATGCAGAGCTGCTATTTAGTCGTCTGGCGCGTGGAGGTCCACTGTTTGATACACTGAAAGATTCAACTGGTTGGATTCGAGCACAGTCGACCAGTTCATC
ATCAAAAAATATTTGGAGATAACGACAGTCAAATACCACTTTGAGATTCACCCAGCGATTACTGGGCACCTCGTAATTGTTGGCCCAGCACTCCCACCCT
CGCCAATGAACGCGACAACCTCCGTCTTCCCCCTTTTCCCGAAAATTTGGAAGAACCCCGCGGTCATAAAGTGAAAAGGTGGTTTCATCGTCTTTAGCCG
TGAAGGTCTCGGCGCAAAGTTTGGTGGATAGCATTTTCGGTGTCGACTCACTGGATCCTTTTGCAGCACAGTAATTCAGCATCGGTCTCCAGAATATGTT
GCTCACATATTTATATGCTTTACCTGGGAGAACGCTTGAAAATCCTCTTCGCTTGGATGTTTCTTCGTCTATACTAGCAGAACAGCCAAAAATACTGCGG
TTGGTGCTGCCACAGCAGAGCCACCGCACGAAATCCCCCGTGTCGTCTAGTTCAGGTGTTTTGTGGCGCGCTCCATCCGCCTCCCTATTGTAAACAACAA
AGCAATCAAGTTTTTAGCACCATTTTCGAGAAATATCCAACGCAGAGGATATTCCCACATTTTCGCTTTGGACTTTTCAGTGTCTGCAGCCTTGAGCAGC
AACATACTGATTGAGAACCCGCAAGTACCCAGTAACCGAGACGATTCTCTGCTCTCCGGCCCTTTTGAAGTATCGGACAGCGGGATTTCAAGGAAACCGT
CCCCGTACAGTGAAATAAC