Description :
From Genome Similarity Track
Location :
contig_47:327219- 331301
Transcript NameFunction/comments
g7887.t1hypothetical protein

Sequence
4082 bases(100 bases per row)
AACTCCGAGGAATGATGGAGGATCTTATGAAAATCGTGCGTGACTGGGTAATGTACAAGCCCATTCGGTACTGGACGTTCTCGCCGTGGTTGGCATCCAT
GCTGGCGAACAAATCAGAAGCTCTCGCTCGTGCGTATGTAGTCGAGTTGTTCACGACAGGCCTTTTGCAACCATGTGAGATTGCAATTCATTGTCTGCAC
CAGTGAGTCATCTATTGACTGTACATGTATTTTCTTACGCACTTTGCAATTTACTTTAGGGGAGCGCGAGTTTGCAGAGCGTGTTGCACGCTGGTTTTGC
AGGGTGAAGGTGTGCAAGTCGTACTTGAACCAGCTTTGGCAAAGTTGGATCCCCATTTGCAGCAAACCTACTTCAAGGTAAATGCAAGCAAGTAGTTGCG
ACGGAATTATCTCTTAGTTCCATGCCGACGCAGAACATCGACGACATCGTGATGATTATTGCGGAGTGCTAGGTCGGTTGCAGTGGGGTAAGGCACTTGT
AGGAGTGGCAATGCAGTATCCGCGCCCTCGCCAATCAGTGCAGCACAGCAGTCTGCGAATCCTTCTTCTCCAGCGATCAGCACTGCAGTATATCCGAAGC
GATTACGTTGGTTGATCAGTGACCGAGTCCATACTTCGTCGAGGTATGACGATTGGCGAAGGTGGCGCAGTATCAGCTGCAGGGAAATTAGCGCGTTGGA
TGCAGTTGCAATATGTAGAACTGAATTCCCATCGGCATCCGTCACAAGAACTCCTGCTCCATGGCTAGCGTATATTGATAGCTCTAGTTAGTAAATCTGT
CCGAGACAAGTTCATCGTACGAACACTTACTGAAGAAGGTAGCTGGCAACATCGTGTGCATCCCAAGCGCATGCATACTGCAGAGCTGTGCGACCCGTGT
GATGCCGTTCGTCCAGCAGTGTCGGATTGTCGGTATAAAGAATGGCAAGAGCACAAACATCGTTGTTCCAACGGCTTCCATCCACTGGTCCAGGAGCTCC
ATCTGATCAGTCGCGTGAAAATAATGATCAATTTATTAGGAAGGCACTACATAGTGCATGGCCCGGCATATTTGGTCGATACAACATCAGTCAGTGGTGA
AGCCGTACACCTCGGTCTCCAGCACCGCGTACAGCACAGCCTTCAACTCGTCGCGAACAACGTGCAGTGGCAGGTCCAAACGATTGAAACAAGCGTGGCT
GTGAATGAACCCGTCACCAATCAGCGACACGGCCTTCAGTGTAAACGGGCACAGACGACCATCGTAGCTCGTCAACGCACTGAACCCTCCGAGAGGAACG
CGCGATGAACCAGTTGAAAACTGCAGCAGCCGACGACGATACTCATTTGGCATCTCTCGCACTAGCTCCCAGAACCACTTGAGTGAGCGGTGGTGGTGAA
GGTCTTCCGAATACTTTGTGTTGCGCTCCCAGTCATCTACGTCGATCTCGTCGGAGCCGCACAGCAGGAAGTCGAACTCTTCCGGGTCGAATAGCAGGAG
AAGTTCGCGAGGGACGATTTCGTACAGGCCCTGCAAGAAGACTTGCAGTTGAGGGGCCACACTTTCCACAAGCAGGTATTGCCACTTGAGCTCCACGAAC
TCGCGCTTGTTGGAATCGGTGACGGGAATGGCACTGCCGCCAGGCACGAGCTCGATATCGCGATAGCTATCTCCATCCTTGGTAGTCACGGTGAAATCGA
GATCTAGCGCATCGACATTGTCGTTCTCCAGTAACCAACGCAAATTGCTGTACACCTCTGGGTCCAAGTCCTCCAAATCTTCAAAACTTAACGGGTACCC
AGAATCAGCTTGAGGAGAGGTGAACCAAGTGGAAGCACAGCATAGAACCTTCGAGCAGTGCGCGACCCAGGAGACGGCCGGCCGCATACAAATGCAGGAG
TCGATCCGGCAAAAGATCCATGTTTGAGCAGGGGCTCAAAAAGTAGGCTTGCTCATTTTTGTTGGCATATACAAAGAGACCGCGAGCAGGATCCACGAGC
ATCTCGTTCAGCATCACGAACCACTCGCGATGAAGTCCTCCCGCATCCACTCCACTTTCATCCAGGAAATTAATCCGAAGCACAGAGTGGAGGTTTCGTA
AGGGGATAATGGCGAGGGACTCCATAGAGTCCTCGAACACATTGGCACGCTCCACATTAAGCCTCAAATGCTCTCTCTCCGCTGGAACCAAGAGTGTTGA
CGTGGCGGTAACGAAATGCGCATACTTCGAGGGGAAGTCTTTGCTTGCGAGAGCTATAGTCTCGCTCGGCGGCGGCGATGTCGTTGTGGTCTCACGTAAG
CTGCTATTTGGCGCATTTAATTCTGCGCTTCGAGGTCCAATCTCAATTTCCAGGGGCAGTTTCGAAGCGTCCACAGTGGTGTCAGAGCTGTCGTGAGTAC
TGTGTGCGTTGCTTGGGAATTGTGTACCAAGTTGGTAATGCATTCTTCCACAGATCCGAGCAATGGTTCCTGCTCTCGTATGCTGTCCGTCCAAGCGTAT
TCGCGTTCTCTGCTGCAGCCAGTTCGTGTTCTGGTTCGGGTTCGGCCGCATCCGTTCCAACAGAAGATGCCGTTTCCGTATTGTCAAAGGCAATTCGTGA
TGGTGCAGCCGGTAGCAGTGGTGAACCATTATCTCTAAGAAGGACAGTTGATAGCTCTTCCGACACGGATTCTTTATCACCTTCACACGTCGTCGCTCCT
TGTTGAAGCAATGGCAAAGCATCAATCCCATTGGACTCACCACAAGTAGACAGGAACTTGACAACAAATCCCGTGAATCGCGTGTCCGTCCATCGTCCAT
CACGGAACCAGAACGTGCGTCCTTCAACGTCCACTTTCCTCGTCCACTCTTTGCGTCGCTGTGCCCGTAGTCGACGTCGAGTCGTTTGGTGCGTCGGCGT
AGCCGTGACCAACTGCACGCGACTCTCTCGCTTGAACAGCGGCAAGAACGATAGTCTCGGTGCCTTCTTGTCTCCGTTTTGCTGTTCGTCGTCCGCGAGC
GCCTGTCCGCACACGGTGCAGAACTTGACACGTCTGAAGTTCTCGAAGCTGCAGACTGCGCAAACGTTGAATCCCTCCTCCGCGTCTCTCAGTGCCGCGT
CCAGTCGTCGATCGTCAGAGCTGCAGCAATTGCAAAGTTAGTGTAACTGGGGCCTCAACGGAAGAGCAACGACGCACTTGAGCAGCGGCGCGTGCAGCTC
CAGCGACCGCTGGCGACGGATGTAGGCGCGTCTCGCTAACAGCGACAAGCAGCAGAAGAGCAGCGCGATGACTGCCAGCACAGCGAGGAAGCCCACCACG
GCCTGCATGTCGTCTCCGGATGAATCTGAGTGTGGCGTGCGTCAAGCATCTGCGATCGATTACCGAACTGGTAGATGCAAAAGTGTTTGTCATGGGTATA
GTTTAGATAGATTATAAGAAATGAATAAAGAGGAGAGGAGAGACTTTTGAGGAGTACTGTTGTGTCCAGGTAGCGGTACAGCAGATGAGTGTTGAGCTGC
GGGCACCGTACACCGAACGCCGACCGTGCTGATCAACAGGATGTTGCTACATGGCAGGAGCTAGGAAGGCACAGGGCAATGTATATCGCACTCACTTACT
TAATATCACTCTAGTCTGCACCCAATAAACTTCACTAATCGGTTGTAAACCCGTACACCTCGGTCTCCAGCACCGCGTACAGCACAGCCTTCAACTCGTC
GCGAACAACGTGCAGTGGCAGGTCCAAACGATTGAAACAAGCGTGGCTGTGAATGAACCCGTCACCAATCAGCGACACGGCCTTCAGTGTAAACGGGCAC
AGACGACCATCGTAGCTCGTCAACGCACTGAACCCTCCGAGAGGAACGCGCGATGAACCAGTTGAAAACTGCAGCAGCCGACGACGATACTCATTTGGCA
TCTCTCGCACTAGCTCCCAGAACCACTTGAGTGAGCGGTGGTGGTGAAGGTCTTCCGAATACTTTGTGTTGCGCTCCCAGTCATCTACGTCGATCTCGTC
GGAGCCGCACAGCAGGAAGTCGAACTCTTCCGGGTCGAATAGCAGGAGAAGTTCGCGAGGGACGATTTCGTACAGGCCCTGC