Description :
From Genome Similarity Track
Location :
contig_54:327207- 328759
Transcript NameFunction/comments
g11301.t1hypothetical protein

Sequence
1552 bases(100 bases per row)
ACACTCCTGGCCAAATTAATACGGCCACCCACCGATTTGACTGTAGCTCAGCCAATTCTACAGATATGGCGCTGCGGTTTTGATATGTGTTTTGTATAGT
ACAGAGAAGCACAGTGTTTGTATTAACAACTGCGATTTTGCGGTTTGTGGGGTAGCTCCCATACAATACACCGTTTTGGGCATGCGGTCCAAATTTCCGG
CCACCCGAGCCCATACTAAAATGAAGATATATGTAACGAAAAGATGTATTAGTAATACGTTTTACCACCCTTCTTCTCAATCACTTCAATGCAGCGTCGA
GGCATTGAATCTATGAGCTAGCTTGATCAATGTTTTTCCACGCCGCCAATATAGCTGCTGTCAAGTCTCCAACATTAGTGTACTGGCGTCCGTTGGGGTA
GACTTTGCGAGCCAGCAACGCCCACAGATTCTCGATGGGGTTCAGGTCAGGTGAACGGGAGGCCAATCGAGCACGTTCGCTCCTTGCTCTTCAAAGAACG
CCTTGGTCTTCTGCGACGTGTGAATGGAGGCGTTGTCTTGTTGATAGACAAAGTCCATCCCGTAGTTTAGGTGAGCATAGGGTAGCAAGAACTCCGACAC
AGTGTAGATGTACTGTGCCGAAGTCTGCCTCCCTATCAGCACCGCGAGCTCCGTCTTGCCCTTGGCGCTGAAGCCGCCCCACACCATCACAGAGCCTCCA
CCGTTCTGACGCCTCACTGTGTTCTTGGCGGTCGCCTCACGTCGTACCAGTAGCGTTGGAGGCCGTTGGGCCGTCCAAGTTGAACTTCTTTCCATCTGAA
AAGGTGATGCGCTGCCAGTCCTTCTTCGACGTAACAACCATGTGTTTAGCCCACTCGAGACGACGGGCCTTGTGCGCGGCTGTCCGTGCCAGCGTGTTCT
CCATCTTGGTGCAGATTAGCCAGTCTACACAAGCAAGGAGACGCCGTATCGTGCGGGGTGAACACTTGCAGCTGCACTCCTCTTTCAGCTGCGCGGCCGT
GTAATCGCCGCTGGCCGCCTTGCGAAAAGCAGCAAACGGGCAAGCCTCTCTGACACAACGGGCTTCTTTCCAGGTCGGCGGCGATTCCGGTGTGGCGCAG
CAAGGGCTCGTTCAACTGCGTAGCGTGAGTGCTTGACTCTTCTTGCAATAGCTCGGAACGAGAGCCCTCCTTCGTGTAGTCCTCGAATGCGTCGTTTCTC
GTCGCTTAGCCAAGGCGGCATCGCCCAGTGAGTCTGGAAATGAAGCAACTGTGGTGGAGACCTAGTATTCAACGGCTGGACAGCAGATCAAGTCAAATGT
TTAATCTTTTCGTAACATATATCTTCATTTTAGTATGGGCTCGGGTGGCCGGAAATTTGGACCGCATGCCCAAAACGGTGTATTGTATGGGAGCTACCCC
ACAAACCGCAAAATCGCAGTTGTTAATACAAACACTGTGCTTCTCTGTACTATACAAAACACATATCAATACCGCAGCGCCATATCTGTAGAATTGGCTG
AGCTGCAGTCAAATCGGTGGGTGGCCGTATTAATTTGGCCAGGAGTGTAGCA