Description :
From Genome Similarity Track
Location :
Scaffold_248:32719- 35775
Transcript NameFunction/comments
Phyke_g7206hypothetical protein PHYSODRAFT_470590

Sequence
3056 bases(100 bases per row)
gttgctgctgctaggCGCAGCTTTCCACGCTCTGTGCATCctcagcatcttcgacaTCTACTTCCAGTCGCCCGTTGAGTCCTCCATCCCCAGTGCCAAC
TACACCTCGAATCCCCCAGCCAAGCGTGTCATCGTGTTCACTGTGGACGGATGTCGCGTCGACAAGCTCTACAAGGTCACAGCAGCCTTCCCGGACCGTT
TAAACCTCAATCCTGCCTCTAAAATGGCCTTAGATGACCTCCCCAATAGCCGAACACCATTCCTGGGCGACGTCATGCGTCGACGTGGCAGTTGGGGCAT
CTCACATAACCACGTGCCGACTGAGAGCCGTCCGTGTCACGTGGCGTTGACTGCAGGAATGTATGAAGACCCCCATGCTGTGaccaagaactggaagcaG
CATCCGGTGCCTTTTGACTCGGTGTTTAATCAGAGCAATAATGCCTTCATTTTTGGCAATAGAGATGTGGCTCCGATGCTGGCGAGACATGCGCCACAAG
CTCATGAAGAGCATTACTCGGCAAGGGAAGAGAGCGAAATGGCGAGAGAAGACCCGTCTCTGTTGGATGTGTGGAGTTTCCGAAAGATAAAGGCGTTGTT
TGCAAAAGGAACGGAGAAGAGAGACTCGGAGCTATATGCGCAGCTGAATCAAGACAAGTTGGTGATTTATTGCCATTTCTTGGGAACGGACTTGAGCGGA
CCGAAATTTGGAGCACACTCGAGAGAGTATTTGGAGAATATTGCTGTGGTGGATGAACTGGTAGAGAAGACAGAGaaactggtggagaagtactTTGGGT
ATGATGGACGGTCGGCTTATGTGCTGAACTCGGATCACGGCATGGATCACCGAGGCGATCACGGCGACGAGGCCCCAGCTAAAACCCGGACGGCAATTGT
CGCTTGGGGTGCTGGTGTCCAGGGGCCTATCGCTGTAAATATCACAGGCGATAGAATGTTTGATATTGAACTGCCAACCCAGTCAAGAGCGGAGATCCAA
ATGCGTTTAGGAGCCCAGCAACACGAGGAGCAAGTCGCAGAGCGTGAATGGGCAGCTCTGACGGGTTTGAAGCGCAAAGATATCATGCAAGCCGACGTGG
CACCGCTTATCAGCGCGTTAGTTGGACTTCCGTATCCTCGCAACTCGGGAGGCGTTCTGCCGTTTACGTACTTGACCAAGAACAAGTACCGTGCGAATGC
TGTGCGCGCCAACGCACAACAATTGTATCAGCACGCATTGCAAAAGGAAGAAGTGAAGCGTGCACGCCGAGGGTGGCTATTTGTTCCATATGAACCTCTC
CGTAGTCACGCACTAGACCTGGCAGAACAGATCGATAAGGCCTTGAACGACATAAGCGATGATGAGAACGAGGACCACACAACTCGAGATGAGGAAGCGC
ATCAGCTTGTCGAGACGTTGAGCCAGGAGATGATTGATATTAGCCGAAACGCGATCGTGTATTACCAGAGATACGACTGGCTGTTTCTGTTTGGCGCCAT
CGTTCTGGGCTATGTCGGCTTGGCCCTCGTCTTGGCTGTGGCCTATATAAACCCGTTGGAGTTCCGATTGCGTTGGCTATTGACCCACACGGTCGATGTC
AGAAGTGCTGTCGTGGCGGCTGTGATGATCTGGTGGCGATTTCTTGCGGACTCGCCAGTTTCGTATTATTTGTATGGTTTGTGTCCTGTTATTTTCTGGC
GCTTTACCTGGGGCCACCTCGATCAACTccgagcagcagtggcatCTAGTCAGCATAGAAACAAGACAATGATGTCTTCGTGGAGAGGCAGTATTCATAC
TGCTGGGGTTTTCCTGTGTTTGGAGCTTGTTGTCCAGGGCTACACGCGTCGCTCGATTTTTAGTGTGCTTTTGGTCAGCCTCGCACTCTGGCCGTGGATT
TTCACTGATAGTGCTTCTGTGTTACGTGAAGCCACGAAGCAAAGCAAAGGTTTAAGTACGAGTAGACTGCTATCACCGAGTGCATACTGGACCGTGAGCT
GCCTCTTAACTGCGATCTTCCCGTGTTTACACGTTGAATACGGTGCCAACACACCACTAGTTCATCTTGGCACTTTACTCACGTTGATCTTCGCGTTCAC
TGTTCTCCGGAACACCGTACCAAAGCACGATTCAAAAGGTCAGTTGAAAGTAGTGCTTGGAGCTGGGGTACCTCCGGTACTAGTGGCGCTATTGACCTTG
CAATCGACTGTGGGCTTTTTCGAGACAAATGTCACCCTACCCTTTTCCCTAGTCGTGGCGAATTGGGCGCTGGCAACGACGCCTCTGCTATCGCTACTCT
TCCGGATAAAGTGCCAGAGCAACGTAGAGACACCACTTTCTCTCACAAGTGGAATTAAGAATGATCTCGAGTGCCAACAGCCTACGCACGACAACCCGAG
CATGCTGGTTGTGCGACTCGTCCAGGTGATTTTGGCGTTCGCACCTTCCTTTGCCCTACTCAGCACAGCATACGAAATGCTGTTCTATGTGGCCCTATGC
TGTGTTCTCGTAAgctggttgctgctggaagcagagcaagtgTCCTCTTCTAGGCTCATGGTGATGCGTGAGACGCATAGAGCTTTGAtatttctgctgc
tggtccAGGTCTCATTTTACGGTACAAGTAGCGTTACAAGTATGACACATTTCCGGATTTCATCCGCTAGCCGCTTCTTGACACGCGCGTCACCCTCCAT
TGCCCAGGCACTCGTTGTGCTGAAACTGCTGATTCcgttcgtcgtcgtggccTGCACTTTTCGCTTGATCCTGCTTCTACCGTCGAGAGCAGACACTTCC
TCAATATGGGAAAAGGACATGAAGTGTGATCGGCGACTACCAATGTCGAGGTATTTTCTCCTGTCAGTGGCCATGGCAGATGTGCTAGCGGTGCGGTTCC
TCTTTCTTGTCAACAACGAAGGCAGCTGGAAGCAAATGGGCAACTCCATTGCAGTGTTCTGCATCGGTAATGCTCAGATTGTTCTCTTACCAACCATTGC
CCTGCTCGCCTGGGGTTTTGTCCACGACCTTGAACCCCCTTCGTCTGCTGCCGATG