Description :
From Genome Similarity Track
Location :
Scaffold_78:32709- 34823
Sequence
2114 bases(100 bases per row)
GACCGCGATACACCCACTCCAGCTTGGTCATTTTTGCCGCCCCGAAAGTTGATCTGGACTCGATGAACATTTTGCTTGCGCTCGCAGCGTCGTCCTTGGC
GGTCGTAGAAACACACGTCGGACCGTCGGATTGCGAATTGGTATTGATGTGCGCCGTCACGAAGATATTCACTGCGCCTCAAGAGAAAGAAGAAGCCCAT
GACCGTAGCCTCCCATAAGACACGGTCATGGGCTGAGTTGAAGTTGAGTTGCTGATGGATGACTCGAAGCATGGGGAACGTGAATGGTTGCTTGGGCTGC
GGGGATGGTTGGAGCCGTTGGATGCCCTTGATTGCCATGTCGTGGTGAGGGAGGAGACCGATGTTAAATCCGAGTTCCCATCGATGATACCACGCGATTG
CACAGATCTTGGACTGGATGGTCTGTAGGGAGTTGCCTCTGGAGACGGATGCCCCATTCCCGTACCGATAGCAGAACACTGCGAAGAGAACAAGCTGTCG
TGATGCGACTGTGGGGTCGTTCGGCAGCCACGGACTACCCTCCATGTCTGCACACCACCGCGACCACTGCTTCCAGGATGACTGGTATCTCTTGACGGAC
GACTTGGCCAGTGAGCTGGACTGCAATTCTCGGAGAAGTCCTTGTAGATTCGCCTCCAATGCGCGGGCACTTGAACCTGGCGCCACGAAGAAGAAAATGC
AGACCATGTACATGCGTAAGGTGATGACCACGCTCGTGAGCCAGCGTCTGCCATGCGGTTGATTGCTCCCGGGAGGTGCCTGGCCGAGAGTCGAAATCTG
AAGACGGCCTCAGCAAGCCCTATTGCACGGTTGATCTCTTGGGCGAATACATTGTTGGAGTGTAGACGATGGGTCCATGAGACAGCGGATAAATTGTCGC
TCCAGCAGACAACATGAGGGTAATTGAAGTTTTGATGCAGGTGGGGTCCCCAACACCAAGCTGCGAGTGCCATGCAGAAGTGCTCGCGAACGTTGATGCT
GAACCCCGTCGCTTCTGCATCCGCGATGAGCTGTAGTTCTTCCTCGTCGAACTGGAGCTGAATGAACTCGTCTCTGGCGGGATGAAGTACTGCCAAGCCG
GTGTTCGAGGCGTCCATGTAGAAGTTGACCGTCGGTTTAGGGAGATCTCCGAAGAAACGCAGCGGCAATTTGTCGAGATGTCCATGCGAGAGAATGTAGT
GGAACCACTGTAGGTCGCGCCGTGAGGCTGCGCTCAGCCGCACCGATTGAAACGGGCGAAGCCGATTGCACACGGACCGAAGCTGCTGAAAGAAGGGCTT
GGCCGACCGAAGACACGCGGTAATGTGGCGGAGGCTTCCGAGGAGCTGCTGGTGCTCTTGTTTGTTGACCTTGGTCGAAGACAGCAATACGGAAACACGA
TCGAGGCCCTTCTGGATCTTGTCGGGTGGCATCGTTACTGTGAGATCGACAGTATTCCAGATGAGCCCGAGTGCTTGCTGCTCGGTGGACCACGATGAGA
ACTTCCGAGTCGTTGATGCTGTCGGGTCCAAGAACGGCCATCATGCTCAGGCGTAGTGTTGCCTCAGCGAGCTCGAGACGGGAATCACGGTCGGGCTCGA
CGAGGATGTGATCATCCACCCACTCGTACCCGAAGAAGGCTTCGTTATCAGAGCTTTCAGACACTGATGCAGGAGAGTTGGCGCTCACCAACCAGGAAAT
GGCGCGCCCGAAAGCACTGTAAAAGGCTGGGGAACCGGACCACCCGAACGGGGCCGCGAGATTGATCACGAGGGCGTCTTCGTCTGGGAAGGTAGCACCC
ATCCAGCCGACGTGCTCGGCGTGAAGCATGAGATGGCAGTAAGCTCGTTTGACGTCTCCCTTAAGAATTTTTATCGCGATACCTGGCTGAGTTCTGGCCA
GTTCTTCGATTCTTCGAGCAATGGCGACCACACTGACGTAATTGATGTCGGGTAGGCAGGTAGTATCGAAGTACGCATTCGTGGACGCTGTGTTCGGATG
GCTGAGATCGTGAATTGGGCGGACTTCGACCAAAGGCTCCACTCCCTTCTTTCTCTACCGCACCGAATGGGCTGCATGGATGTTCTTCCACTGTTCGAGT
ATCGATAAGCTGAC