Description :
From Genome Similarity Track
Location :
Scaffold_14:327052- 329760
Transcript NameFunction/comments
Phypa_INRA-310PPTG_08445hypothetical protein

Sequence
2708 bases(100 bases per row)
TCGGAAGAGCTTAAACAAGCAGACGGCACCGAAGGTGGCCACGTGTTGGACGCAATATCAGCACCGCACGAACTTGGGGACGAGGAATGTGTATCAGCGA
AGGGGGCGACTTCTATGCAGAAGACGTTGACGATAACATGGCAGTCCTTCCCAGACCTCGCTGAACCGACGGAGGAAGCGAAGAACGAGGATATCCAAGT
AAGAGATTCAGATTACAACACAACAGAGGCAATCGACAAATTGAGGCGAATCATCTGGCGACGTCACCATCTTCAGATCGGAAAGGATAACGCCTTACCA
CCAGCTGCGGCAGGCGTCGTCTGCGACATAGATGTGAGAAACACCAAGCCCGTGCCCGAATACTCGCCCCACAGCTCCGCGAGAAGCTGTTCCTGGTGAT
CAAGGGACTGTTGTCCGCCAAGACCATCAGCTACTCCACCTCGCCCTGGGCGTAACCCATAGTTGTTATCATCAGAAGAACGGCGTGGACATCAGACTCT
GCATCGACAATTGACTAGTGAACAGCCAAACACGGTTAATGATGTACCCGATGCTCCTGATTAATGATATGCTCGATGATCTCGACAAGGCTATCTGGTA
CTGCTCGCTGGACATAGCCAGCAGCTTTTGGGTTGCTTCGATGTTAGATCGAGCCCGAGCGATCTCAGCGTTCATCACGCCTTTTGGATTATTCGAGTGG
AACCGTACGCCGTTTAGCCTCAAGAATGCTCTTCAGATCTACCAGTGATTGCTAGATAACGCGCTATACGGCTTCGTCAAGATCATGAATAACCAATATC
GTGCCAACAAGACTGACGTATTCGAAACTGGAGAACCCGATCAGGGTATAAAGTCTTCCGTTCTTAGACGTCGATCTTATATTGATGACACCCTTGTGGC
GGCGGGACTGTGTGAGATGGCAGACAAGCTTCTGGACGTATACGGCGTGTGGAAGTTGTCCATTAGCGTGGCGAAGAGCGTCTGGGGATGGCGTAAGGTC
GACTTTCTTGGCCATTGTGTTTCCGCAGACGGACTTGAAGCCAAACCGAAGGATCTGTCGGTTCTAACCAAACTGCCCTTCCCAACCACGCTGAGATCGA
TGCAGTCTTTTTGGGTAGTTTGAATTACTACAGTCGTTTTAAACAAAAATGTTTTTTCCATCAAAATTCATCAAATACTAGAATAAAATTTTTATGTGTT
TTAACAGGACGTTCTAAAAGTGTTTATCGTTTATTTAAAATTTCTAGAATTCAATTACGTAAATTAGCATCAAAAGGATTTTTACCATCGAAGATTTAAC
GGTCTATGCTTCGATACTGTATGAGCTTCGGGAAGCGGATTTCTATGAGATCGCCCAGAGGTCCAAGATCGAGACCGTAGCTGGGAACGATAATAGACCT
GAAGAAGATGGCAAATGGACCAGATCAGTCAAGGCTTTCGAAACGCTGAAGGTCAGGATCGCCGCTGCGCCTATTCTTCGGCACTTCGCTTCCAACAAAC
AGCCCGTCGTGGTAGTGTACGCCAGCAAGTGGACGATCTCAGCAGCTTTGATGTAGGAACAGGATGGCACGTACCAACCTGTGACCTTTGCAAACCGAAC
GCTTAAGCCGAGAGAGGTCAATTACGGGATCATGGATAAAGAGGTGTTGGCGCTTCTAAGGATCCTAGATGTTTGGTACAGACAAGGTCAATCAAAGTGT
TGACTCGACATTCAACATTGGGTTGGCTGTTGCATCGTCGGTTCTACTAGGGCGATTAGGAAACTGGGCTGCTCTTCTGTCGAGTTGGACGCTAGAGATT
GTCAAGTGTACCAAGGGCGAGGATGAGATCTTGAGAGCGATCTAAGCTAGCGTCACCCCGCGTGCCGAAGCGGAGGTGCATACAGTGCGATCGTGTAGAG
CTAACCTGAATGGACTGAGGTCTCGGCATCGCCCGAGCACAAGGTCAATATTACCGTCAATAAGGCAGAGTACCACGGTCTACAACTCGGTTTCATGCTC
GTGTCTGACCTGGACAGGGGACGACTTGTTAACTGTGGCGACTCGAACCTGGTGGTTCGGCAGATGAGTGGAAAGATTGAATGTAAGTCGCCGAGTCTGA
AATTGCCCCGGCAGAAAGCAATGGATCAGTTGCGATCTTGGCCAGAACATGAATTTCTCCATGTGAAGAGGGACTGGAACCAGAGCGCTGACAGTCTAGC
AAGTGCGGCACTGCAAAAAGGTGAAGGTTCCGTGATCATGACAGAAGCCAACCGGTATGATTTGATAACGCTCAGCCACTTGCCAGAGTTATTGGTCCCT
CAATCTGACCAGACGGTGATTAAGATTACAGCCGTCATGAGATCGCACCGGCGACACAGGCCAGAAGTGCTACAGGAAGTTGTTGTACAGCGAGTACCAA
CGGATCGAATTGCTCGAGCTCAAGGTGAGGAGAAGTGGGATGAGGACCTTAAGATGTATTTGCGAGGGGGTGTGCAGGATCCGACAACGACGGAAGCTAA
AACCTGTGCCAAGATCGCAGAAGATTTCGAGACCGACGAGGCCGGCCTTCCCTTCTCCTGTCCTCCGTCCAAACAATCTGGCAAAGATGGCGACCTCGTG
ATGTACCAGAATTGTTGCAAAGCGACATTCTTCACCACTACCATAGCGTCACGGTGCCGACAGACGCCGACCTACCGACACATAAACGATCAAATCTATA
TTGAAGGG