Description :
From Genome Similarity Track
Location :
Scaffold_280:32704- 35344
Transcript NameFunction/comments
Hyaar_Emoy2813464hypothetical protein
Hyaar_Emoy2813465hypothetical protein

Sequence
2640 bases(100 bases per row)
ACTTGCATAGTAGTGAAGGAGGAGAGCAAGGACAACATGTTTGTGAAGTAGACGTGCAGGTCGTCCTGGCTTTCCTTGACCTGAGCTTACAACATAGTGA
CGTGAGAAGACGCTCAATAGATCATCAAAAGCAGCACGAGGAAGTCCGATGACGTTCATTAGGTTTGCTTTTGTCCCGCCCCGGTGTATGGTGTACCACG
GCGAAGCAGAAGGGCTGATAAGCGCCTGAGATGTTAAGTAGAAGAGCTCACGGATTGTGCCCCGGATGCGAAGAAGAAGAAGAGCACGGATGACTTTTTG
ACGACGGTCGGCTGCTGCCTGCTGTGCTGCCTCCTCTTCTACAGTATACAGAGCAAGGGCCCATGCTTGATGGGCTTGATATGGAGATGACATTAACGGT
GGCAGTATTGTCAGTACAAGTAGCGTAATTGGTAGTTTTATTGATATTTATCAGTTGTCGCTAAGGTTTTTGGTGGCCGAAAACCTTACAAATGCATTTC
ACAAATGGCATTTGTGAAGGGTTCACAGACGGTGTTTGTGAACTCTCACAAATAGGGGTTTTAGTGGACTTCCAGTGGCTGCTTGACCGGCTGAATTTTA
GATTTTTACTGGCTGGCTGTAATCACGATGAGGACGACCGGACAAATACTGCGGGCCATTCATACATTTAGTCTTTCAGTTATTAGCTCTCAGATTGGCC
GACCACAAGCCTAACGTAACGGAGTCTGTGAGTAGAAGATGCATTCGAGGTTTGTTTGCTCTTTCTGCCCGGTATACGCAATGCTCGACATTCGATATTC
GTCCTGAAGACAATGCGGTCTTGTGTCGATGGACGGCGCACGTTTCAATTAGTCCCCACAATTACAATTGCCTCGTGCCACCCAACCACAACCTTCGAAA
CTCTGCGGCAACTCACCTCGATGCCCCCCCCGCGATTCTGCGCTTGGCGGTGTTCTACACCATGTTGCTCTCGTCCGCAGAGGCTACGGCCGAGAATGAC
GCACAAGCTCTCAAAGCTGAGGCATCAAAATTTTCACAGCCTCTTCTCGTCGTCGTCAGGCCGGATCTCAAAGGTCATCCTGGAACCACCTATATCATGA
ACGCCATACCAATTCGCCAATTTCCAGACGTCTGGGCGCTACGACGTCACCGCTACTCTCAATAGGAACGGTTCACCGACTACGACCTGACTAATGGTAC
CGCCCACGTGACTTACACGTCCAAATCGAAAGGACTCGTTTGCTTGGTTTCGGAATCTGGCCAATATCGGATTCCGCACCTCAATGCGATTTTCCAGGGA
ATTCTGAACATTTCGAATGATGCGTCATTTACCGTCAGCAAGGAGTGCGTGAAGGAGTACACTATCGAGATCGACGGCATGCCCTACTACGTGTGTGACC
TGCAGAATCCCGCCGCGCTCAAGGTCACTGGAGGAAACATGATGATCACTCTGGTGCAAGCTTACCGCGTAACGTTGACAACTGTCGAAGAGCGGCCCTC
TACGTGTACGCAGGTGGTGTCCCCGTTTGGATTGACAGGCGTAGACTCTATCGGCTACAAGTTGCTGAGCTTCAGTTAGTTTGTAGTCGTGCTTTAGAGA
GCAAGAAGTCTGTTCGCTAGCCTCTGGTAGTTCGCATCGATAGATAGATTTTCTTTGGCTGCGTCTGGCTAACTTCCGAAAGAAGCCGGCAGAAGCTGTA
CAAACGTACTGCAATGGTAATACCAATCATGGATGTGTGAAGTCTTCTGGTGTTGTCTTGTCTTCACTTATGCATAAAGCGAATTTGAGCACTTCCGCTT
GACGTGAGAAGAATGCAACAGGGGATAGATAGCCCGTTAACTGATTCACCGAGATGCCCCTTAATATCTCTATCAGCCTTGGTACAGGTGTTGCGTGTCT
CCTAGTGGACCGCCACTCTAGCCCGGAAGCGTCACCTTAATCGCGGTCCTCATCATCCCATGGTCCAGTCACTGAGTCTCTGTGCACGGTGGAAGGTGCT
AGTGCCGCGTTTCGTCGTCCTCGCACTGCATCTGGGCGAAGACCCGCTTTGGTTCGGCATCTATCTCCGCTACGTTCAAGTCACAACGCAAGGGAGTAAG
CCGCTCGAGGGAGAAGATCTTCAGCTCACGCTTACTGTGCGATCATACGGCAAGGCGCACGAGTGCCGCGGCACATGCAGCTACGGCCAGCGCATTCTTC
TGCTGATGTTCATCGATTTTGTATCGGAATCGTTAACCACCAAGAGTTGAACGAGAACGTAAGGTTCAAACAAGGCGGACATGGACATTTACGCGGTTTC
GTGCGCTTCTCGGACCACGTCCGACTTGGGGACAGACAAACGTCTTCAAGTCTACATTCTAGCTTCGCAGCCGCGTTGTGTCGATGTCGTTGAACCAGTA
GACAACGCCATCCGTGCGCTTGACGTTCGCGGTAGGAAACAGTGGCATATGTTTCTCATTGCCGATTTGTTTGTGGCATCAGCTCGGCCATGCTAGCTCC
CGTAGCGACGAAAGCGATCCACAAACGAGAGTTGTGTCATTAATAGGTTGTCCAAGATATCCGGTGACTAGACACGAGATGCATACGTTGGTGGTATCGT
TTATGACTAAGTAAGTGAGCGTGATGAGCTGCGACGGCGG