Description :
From Genome Similarity Track
Location :
Scaffold_1442:327- 4438
Sequence
4111 bases(100 bases per row)
CTGATCACCAAATTTGAATCCCCACAAATCACCAGCCGTTTTGGATCTTGTCCCTTTAGTAAATCCAAACCCAGAAGGAGTCCGTTATACTCCGCTTCAT
TGACGGTGAGGCCTTCCGCGTAAGTGGATCTGGCCCGTACAACTTCCCATCCGGGCAATTTCCACAGTATTGCACTGTATGCTCCTCCTCCGCGTCGTAC
ACGAGCGGATCCATCGAAACTCAGGACGTATAGATCCTCATCCACCTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGGGCG
ATCTTAGTCAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACATTCTCCA
GCGTCCAAGGTGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGTCGACTTGAACAGCCAGCCTAGCGTAGAGTGTCGAGTCAGGATCCG
GATGGATCTTCCCACTAGCAGGTTGTAATTCAGATCTAACACGCGTAGGAGCGCAAGTATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTC
AGTGTCCGGCTGACAAAGGTGACTGGATGACAGATCTCTTCATGTTCTTGCACCAGAGCTGCTGAGACTGCCCAGTCACTGGCATAAACTATTACCGTAG
GTTGACGTTCCGGATCGAAGTGACGGAGGGATAGGCGTGGTCGCGATTCTGTTCCTCAATTCCACGAATGCGTGTGAGCTCGGATCCACCGAGATTCTGC
CTTTTCCAAGTCTGATCCGTCGTCTCTATCCAGACTGGATCCTCTCTCTGTTGGTCCCGGGTGATCCAGCTCCGTTTCAGGTCTCTTCGGCGTCTACCAC
TGGATCCTTGCGAGATCCGACTTTTCCTGGTTTAGAGCTTTTGAGTTTTTCTTTGGACAAAGGGAGAGAAATTGGGAATTTTTCTTCGCGGCATAATCTA
CCTCTCTCAATTCGTACAATACCGCGGCAAACAGGGCGTGTCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAAGATTGCATCGCCCGGAAC
GACTGTGGGAAGGACAAATCGGCTAATGAAGACAGATCCTTAGGATTCGCCTCCAATCCCTCCTTGGAAACTCGATGGCCCAAGTACTCCACCTTGCGCA
TCCCCCAATAGCGCTTTACCACACTAATAGAGAGATTCCACTTAGTACACGCCTCCAGTAAGGACGTCACTCTCTCGCACAACTGATCCCACGATTTCGC
CGGGATTATAATGTCGTCGATGTAAGATCTGCGTCCTAGCACGAACGGGGTTCCAGGATCCCCTGGCTCTCCTGCCTCAAATGGATCTACTTCCGTATGA
TCTTCCCCGGATCCACCCCTTTTGGGTTCCGGTATTCGGGTGAATCCATAGAGAGCGTTATCGATTAGACGTTGGTAGATCTGGGGTGCGTTCTTCAATC
CAAACGGCATCCGGTTCCACTCGAACAGTCCAAACGGTGTGATGAATGTGGATATCGCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAACCACTGGC
CATGTCTAGAGAACAGTACCAGAGTACTTTATCCAGATCTTCCAACAGCTCGTTGATTAGGGGCATCGGATACACCATCAATCGAGTCAGGCTGTTAACC
AGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACCGGCGACGCCCACGGGGACGTTGAGAAGCTGATGATCCTGG
CTTGCAGCAGGCCCTTAATCAGATCCGACAGTTTTTCTCGGAACTGAGGTGCCACCTTCCGCACCCTCTGAGCGATCGGTTTCGCGTCGCCGACATCGAT
GTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCGATGTCGGCTCTCCCAGATTTTCTGACGCAGACGATCCACTTCAGCAGGTTC
ATTCGCCCCCGGATCCACTTGGATATCATCAATCGTGACTTCTTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCCCAGATCCTCGGCG
TGTAGATCCCCGCCTTCACGGTAACAGACTTGCTCATCTTCCGTCTTCGTAGGATCCACCATTAAATCCAAACACCGCGGCCCTCTCTCGCCTGGCAGTC
CTTCTATCTTCGGGGGTTCAGGTACCCTGGTATCAGGGAAACCACCAGTTGGATCCAGTTGGTCCTCTAACGAGTTTAAGCCCGACAGTTCGGGTTTGAC
TAGTGTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAGTGGAAAGCTTGGATCCACTTGTGGATCAGCGGGATCCGGCTGTTCGGCTTTAGCCCTC
TGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCGTCCCCTGTCCTGGATCCAGCTTCCATTGCTTGGATCTCAACCCGTC
GATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGCCCAGTTGGCTCCGCTGGGAGCTCCACCTCTGCGAGAGATTCGAT
CTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGTCTAGGGATACCGTCCTTCGCCAAC
CATCGCCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGTCCCTGGATCACGGTCG
GTACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACCCAATTTAACCGATCTGGCAGTTCCCAGATTTCCCCGGGCTCGATCTAGGTCGT
CTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAACGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCC
AGATCCAACCTCACTCCGGCTGGTACCATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATTCCCGACCCAAATGTCAAACCAATACACTAAAC
AACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCGTTCGTACGGTACACGCCTTCACCAATCCCAACACAATCTTGGACCCGACTCCCATCCACTTGGCA
CCCAACCTTACGAGCAAAAGTGGTATCCAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTG
GCTTGTCTAAACCACTTTCCCGGGGCATGGTACTTCCAGTACCCACGGGACTCTCCTGTTAGAAGATCCATGGATCCAACATCCTCAGATCCATAGGATC
CAGTGACCAGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCCTGCTGGCGTTTCTCCCAATAACCACGTGCCTC
TCCCCTTTGTAGATCCAGGGTTGAAGAGACTTCAGATCTGGCAAACTCATCCACTTGGCGCAAACTAGAAATCTTGGCAACTGAAACTTCATGTAGATCA
CGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACCG
GATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCTGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTG
TAGAATTCCTCCATCGGACACTTGCCGACGTCGTGAATCTCGCCACAACCGCGACACACGTAGAAGCAATGATCTCCGGGATGACCTTTCTTGCCACACT
TCTCACAGACCATATGTTTACAGCATCCAGATTCGGTGTGCTTCCGGGATCCGCGCTGGGAACACCTGACTTGTGCTGCCCCGTCCATGAGATCTCGGGA
TCTGTACATCCAACGGTCCCCGGGTACGGAATCCCTCTTTCGAAGTTGTCTCCAGTCTTTGCTGTTCGATCGTTGGACGCAGTTATATATTCTACACGTG
GTTTTCAGTCT