Description :
From Genome Similarity Track
Location :
Scaffold_127:327- 2143
Sequence
1816 bases(100 bases per row)
CACTCAACGGAGTACGTGCTGTATCACTAATACTCAACGAGCTACGCTTGGAATTCATCTTTTCAACATTGGAGTTAGTTAACTCAGACATTCCGATGTC
CAGCATATTGACACGTTCTGTCAAAGGCTCGTACCAATAGTGCTTTTGTTGCCTAGCAAAGGTGGGTTCATGACTCTCCAAAATTTCGCTAGGAACATTG
CGCGTAGCGCCTAAGGTCTTCTACCTCCAATCAATCCATGGCTCATGGCGTTCAAGCCAAGCCATACCTAGGATACGATCATATCTCGAGTCCAAATCAA
GAACAAGACAGCGTTCAATGCTATCAAAGTCCAAAAGCTTTATACCTAAGTTCAAAGGAACTTTAGGTACAGTGACACGACTTCCAGTCGCTAAATGAAC
CGTGATTGAATCACCCTCATGCGCTGTAAGCGCTTCAGCATAAAGCTGACTCTTCTCGAGGGAACGACGTCGAGCATAATTGCAAGACGCCCCAGAATCG
ATTAAAATCGACCAAGGCTTTTCAAAGCCTTTAACTTTCGCCTCAGCGACCAACAAGCCAGCCTTGTATCCACGCTCCATACCAGTAGGTATGGAACTCT
TTGGGGCTAAGCTCTGTTCAACTTTACCTCCTAAAGGTGTTACAGAACCTAGTTCTTCCCCAGTAGGGCGCCCCGCGCCTACTGAGTGTAGGCATTTCCT
GTGCAATGCCAGACTTCTGGCTAGGGGTAGAGTGTTGACTCGTAGCCTGGCGCTGTTTACGCAAAGGGCAACCAGGCGGTAAGTGTTTAGTGCTTCCGCA
CGAAGAACAACGTCGTACAACACGTTGCTGCTCAGCAGCTTGAAGTTCAACTTCACCTTCACCTTCATCTTCAGCATAGCTAAATCCATCGGTTCCGGCC
TATTACCGGCCGGAGTACTCGTGTAGTTTGCTCTCGCAGAGCTAGGGTTGTACCCATTCCAGCCAAGTCTGGCCGACTTGAAGTTATGCTCAGCATTAAG
AGCAATTCTCACAGCCTCTTCGAATGTAAAGGGGTGAACCCGAAAGACTTCGGTTCTGGCAATGCCAGTACGGAGACCCTCCATGAATATATCAGATGGA
CTGCTTCAGGCAGAGGGTCAGACTGCATAGCAGCCATGAGAGTTTTTAGCTCTTGGACATAGTCCGCTAACTCATTCTTACCCTGACGGGTTGATAAAAA
GCGTGAACACACGCGGTAAACCTGGTTAGGTGGTGAAAACACCTGTATCAATTGTGACTTCAGCGACTCCCATGTGGGAAACGCTAAGTCGACCGACGTG
CTACACGTCAAGGCCCATTCTCTAGCTCTTCCATCGAGCTTTGAGATAGCCATCGAGACCTGTTGATGGTCAAGCTTGATCAGGCCTGATCGCATGGCCA
TCTCAATCTTACGGATCCAGAGGATGAGGTTTTTACCCTCCTTTACTGAGTAGTTTTTAACTTTCACTCTAAGGTGACGAGGCCTAGCCCCTTCGTCTGG
AACAGACACATAGCGTGTAGGCTTAGCCGACGCCATCTGGTCTTGAACCTGCCCTAGAAGGGACGCTTGATACTGCAAGAAGCCCTCGACACGTGCAGTC
AGCACTTCCGGGCCTTGCGATACAAGGTAATCCACATACTATGGACCCCAAGATGCGGTCAGCTTATCAAGCGCGACCTTTTGGGCCTCCGAGAGGGAAG
TGGGGTTTTCCATCCTCACAGAGGATCAGTCATTAAAGACTCAGGCGTAGATTGACTACGACTGCTACCAAGTGTAGCGGAGCTACACAGCTCCTTAAGT
CAGAGGAAGACTTAGC