Description :
From Genome Similarity Track
Location :
Scaffold_3949:327- 1693
Sequence
1366 bases(100 bases per row)
CGTCACCAGGCGATTGAACGTCGCCGGGGCGTTAGACAAGCCCTGCGGCAAGACGAGCCACTCCCAAAGCATGCCGCTTGGAGTGCTTACCGCGGTGAGC
GGGATGTCACTCTCTCGCATCAGGATTTGGTAGTATCCGTCTACCAAATCCAACGCACTGTACAGTACGCTCCCGGCCATGTTGTTCAACAACACATCCT
TTCGTGGGATCGGTGTTTGGGCCGGCACCGTTGCGTTGTTCAGCTTGTTATAAGCGTGAACCAGACGCCACTTTCCGTTCGGCTTCCGAACGCAGAAAGT
CGGCGTCGAGTGCGGGGATTTCGATTCCCGCACCATGCCTGCCTTCGCTTTCGCGGCGAAGAAGGCATCAATGACCTCGCACTGTTCGCGCGGGAGAGGC
CATTTCCTCGTGACACAATACTTTGTGCCGGGCATGAGATCAATCTCGTGCCGTACGCCTCGATCCGGTGGGAGTTGGGTCGGTGGGTGTTTGTTCACCA
CGTCCGCATACTCCGTCACCAAAGGATACACCGGATCCTTGGGGTTCTTGAGAATTTCAGAACCCAAGCGCGCCTGACGCTGCTTGTTCATGTCTTCCAG
GACGTTCTCGTCCAAGACAGAGGAGGCGTTCAGCTCCTCCTGAGTGGTCTCAGGTCTCATGAGTACCATCTCAGCAATCTCTTCAGCCTTGAGGTTGGCC
AGGAAAGACTCATCCGTCATTTCCTCGAGGTTCAGTATCTCCGCAACCTCTGGCAACGGTTCCAAGTGGACACCAGATGCCTTGACGGGTAAACCTGTCT
CGCCATCGAAGATGTGATAACACTCTTCCACCGGCCTTGTCGGAGGAGCCCGGGCCCTGGACTCCGAGTCGCTTGAAGCGACGTCGATCGGAACGAAGTT
CGGATCCGACTTGAGGCGGCGGCGGCGTCGTTGCCGACGGCGTCTGTGACGGGGAGCTTTGCTGCCCACGTCTAGGAAGTCGTCGCTACGACATCCGAGG
CACTCGTGGCCTCGTGTGATACTGTTGTACCCACACAGGAAGCGTGTTCAACGCCTTCCTCTTCAGTTAAGGTCTGGGCGACCGCGTGTGGCACTGTGTT
ACCCACACAGGAAGCGTATCCGACGTCTTCCTCTTCAGTTAAGGTCTGGGCGACCGTGAGTGGAACTCTGTTACCCACTCTGAACACGCTGTTCTCAGTG
TTCATGACAGCTGCAGCTGTCTGCGGAACTAAGTTACCCGCCTGTGGACCTAAGTTACCCACTTGGCCAGCGCCTCTTCTGGGCGCGGCCACCATCATAA
CATCCTCGGAGTCGTCATATACGTCGACGACTCCCAAGCATCTGCCGGATGCTTTGGTACCCTGGC