Description :
From Genome Similarity Track
Location :
Scaffold_6:3269294- 3280950
Transcript NameFunction/comments
Phyin_T30-4PITG_04844Folate-Biopterin Transporter (FBT) family
Phyin_T30-4PITG_04845Putative uncharacterized protein
Phyin_T30-4PITG_04846Putative uncharacterized protein
Phyin_T30-4PITG_04847Putative uncharacterized protein
Phyin_T30-4PITG_04848Putative uncharacterized protein
Phyin_T30-4PITG_04849Putative uncharacterized protein

Sequence
11656 bases(100 bases per row)
TGACATTTCTAACTCTATCCTCAAACTCGCACGTCTGCATAGGCTTCTGGCTCCAAGAGCAGCGGCTGCTTCTCGGGTTCGTCCGGCAGCATCAAAATTG
ATTTACGTTTGCTCCGATCTCCTGCAGCGCTAGTGCTTTCTGAAGTGTCGACCTTCTCCGGTAACACACCAAGGAAGACCAGGACAAGAAGTTGACCGAC
AGAAGCGATCGCCACAACCAGCCAGAGATTTCTCCAATCTACAATCTTCGTGGTCGAATCAGGCACAATGCCTAGTGCCGACACTAAGAAGGAGGAAAGT
ATTCCTGATACAACTCCACCAAAGTCCATGAACGAAAGAAACAAAGCGTACGTGAGTCCTTGGACGTCCGGGCTGGCTGGACAGTAATACGTGGCCACGA
CTAGCAGCTGCAGTAATGCGAACTCGGAGGTGAAGGACGTGAGGAACGTCTCCACCGTGCTGAATGTGCACACTGAGACTGGGAGATCGACAACAGGAGG
CGCTAGCAACAACCGCGGAAGGCCAGCGGCAACGGAGCACAACGTGGAGAGGAGGAAGACGCTTCGAACGTTCTTGTTGGTGCACCACTTGGCGTACGAT
AGACACGAGAGGAAGCGACCGATCATACCTGCCATAGACATGTACTGCACGCACTCGTGCTCGTCTTTAAGGAGTGAGAACGTGTACTGGTACCAGATCG
TCCCATCGCTTGGCAGTGCGTTGCACAGGAAGAAGAAGAGCATGGGAGGGAGTACAGGCCGTATAAGCTCCATCTTGAGGTGCAGATCATGCTTGAACGG
GAGCCACCAGGACGTTAATGTGTTGGCCCACGAAGACGCTGGGATCAGCCTATCGACTTCAATAGAGCGCTCTTCTTCACTAGTTAGAAACTCATAAACT
GGTGTTTCTTTCAGTCCAAGAAGACAAACTGCCCCTGCTGTAAGTGGCAGTAAACTGGTCCAGCCGATGACTTGTTGTGGCTTTATATTCTTGTTCATGT
ACACAGGGACGCCCAGTACTAAGGCCGCAATCGACGCAGCGTTCTTCGTTCCATTGGCCAGTGACTGCACGTGAGCGCTGCTCCTACTTGTGGCATCTCC
CGTTGTGAGATCTACCAATAAGATGCCGAGCATGAGCTGGGCAAAGGCCTCGGCGATGGCGTCTACCAGTTTGACGATGAAGGCGCCGGCGATAGAGTGC
ACGTAGGCAGCAGTAAGTACCAGCGACGTGGCTGCACAGACCTCGCAGATGATGATGTACGACTTGCGGCGATACCCGAAGAGCGGGAGACTGTCGGACA
AGAGACCGTAGAGCGGCTTGATGTTCCAGGGGAAGAAAGTGACCGAGTAATAGAGCGTCGTCGTGGCTGGAGGCATATGGAGCACATCGAAGAGCCATTC
TCCGTACGCAGTCATGGGGAACGTCATGTAGAAGGCGTGTATGAAGTACAGAGCCAGCAACGACAACGGCATCCTCGGCGTCGATGGTGCCATCTTGACA
GATTCGCCGGACACATTACCATGATAATCAGGTGTATCACACGGTATATTATGCTTTTCATTGGTTAAGAAAATATCACCTGATGATTCGTTAAAATCAT
TAGCAAATTTCCTCCAATCACAGTAATTATTGCTCTATAACAAGTCACTTTGTCCATCGCCTGGCGGAGGAAGCTCGAGAGGCTTGATGGTGTTCAACAT
CGATGAGGCCGAAGACTTTGACGATGGCACGCGCGCCATAATTCACTCAGATGCGGCATTTGAATCAGATAACGAGACGCAGGACTCGACGCGTCTGCGC
TCGTCCCGTAAGCAGCGACTGCAGGCGGAGCGCAAAGGTAGCAAGCAGCGCGAACAGGCGTCAGCGTTGCGCGTCAAGAACTGGGATGCGGGTTTGATGG
AGAGCGAGGAATATGCAGGGAAAGTGGTAAAGCGCAAGGATCTGAGCGAAGGCATGGAATCGCCTGACGAGGACGCGATGGCCGAGTGGTCGGACGCCGA
GTCGTTCGGTGCGTCGGACAATGACGAGGCGGAGGAAGAAGAAGAGATAGAGGAAGTAGAAAGTGAAGAGGAAAGTGATGACGAGGATAAGAGCGCTGAG
ATGCTTATCCGCGGCTTCCAGAAGGAAGATTCGGCTCGTCTAATGGGTGCACAGGACAGTGAGAAGGTCGTGGAGAAGGCCAAGCACGTGCGCAACCAGA
AACTCATCTGGGAGCGTTGTCTGGAGGTGCAAATCTACACTAAGAGACTGCTAACGACAGCCAAGGAAGCAGCAGCTCACGAGACGGACGGAGAGACGAC
AGATGAAGAGATGGTGACCAAGACAAAGGAACAGGTGGTAGCTGAGCTCTACAACAGCATCGACGCTGTATCTGCCTTGCAGGAGAAACTATGCAACGTT
CCTGAGCTAAACGCTGCCGACACAACGAAGAAGCGTAAACGCACATGCGACGACTTGTGGCAGGAGATCACGACCAGCAACCGCGCGATGCTTCCTCAGT
ACAATGACGTCCTCAACACATACACCCGCAAGACAGACTTGGCAGCAGGAGGCAAGACCAACCAGGCCAAGAAGTTTAAGGCTGTGAACCAAGACATCCT
GGCTCAAGTCGAGTCCGTTCTCGTGGATCCCCAACGAGTCAAGCGCAAGGCACACGCTCCGTTAGACGCACCAGAGTCCGAAGCAGCAGAAGACCAGCTA
GACGAACTCATGTACGACGACTCGGACTTCTACCAGCAACTTCTCAAGGAATTCATCGAAAGCGGCGGAGGTGGCGCTGGCCAGGACGCCTTGGTGAGAC
GCACTCATCGCAAGAAGAAGAAACTCGTCAACCGCAAGGCCAGCAAGGGCCGCCAACTGCGCTACACAGTGCACCCGAAACTCGAAAACTTCATGTTCCC
AGAGCCTTATCCCAGGGCCGAAATGGACGTCACCGAGCTCTTCCGCTCGCTTTTCGGTCAAGTCCGACAGTAAAGACGCGCAAGAGACCGATAGAATAGA
TTCATTTTCTGTGCTTGCTTAAGTCTTTCTTCCACTCTGGAAGATAATAACGCGCCAGCTTCATCTCTTACAGCACGTCGTCTTCTTCTTCCTCTTCCTT
CTCTCCTGATAGATACAGTTCCTTAATCTTCGCCAAGTTTGCTTCCACCTCTCGCAGTCGCACGTCATTCACTCCATTGGCGCCAATCTTCTTGACGATC
CCGACTAATGTCACGGCCTTCTCGGCCACATGCACGACAGCTCTCGCTCGGATCCTCTTGGCTCGTGTGGCATTCTCCAGTGACTTGAACTCTTCCTCCG
CCAAGTCCATCGAAGCATCAGCTAACACCGCAGCAGAGTCGATAAGTTGCGTGCCACGCTCTTCAAAGCGCTCGGGGATGTTGAGCGTGTGCAGTTGACG
CACTTCTGCTGCGTACGAGCCGCTCTTAAATACTTTGTGCTTGAGCTTCACCGCGTCTTTCAATAACTGCGTGAACTTGTCGATCAGTTCCGGTTTCCCT
TTGGCAATCGCGCGCATGGTAGCAGGGGCGTTAAGGATCTGCACACGCTTGGCAATCAACTGGCCGGCGTCACGTTCCAAGAAGGAAAGCCCCCAAAGAC
GTCCATACGCCTTTCCAGCATCCAGACGCTCTTGTTCGGAGAAATACCAGTCGCGTGTGTCCTTGTTCTTGATGAGAAGACGTGATGACCAGGTCTGAAC
CGAGTCCGTTCCGAGAGAAAGACCGTAGTCCTCGAGTTTCGGACCAATTGCCTTGTAAAAAGAGATCGCGTCTTCATCGGTAGACAGCGTCGTTGTCAGG
AGCTTGGAGATTAAGCGATTAACTTCCTCTCGGTTCTCCACGAGCTTCTTGTTGCTTTCCTTCCGTGCCTTCTTCTCCAACTGTTCGATCATACTCATAC
CGCCAGGTCCTTTTGGTTGCTGGGATTCATCTCCGAAGATGTCGTCGATTGCACTCTCTGCAGCGGCGAGTTCTTGGGCCATTTGGTCTTCGACTGAGCG
CAGTGGCATCCCATCCACTCCACCGCTGCTGCCACGACCACGTGCGCCACCGCTTATGGTTCCTCCGTTTGATACTGCATGAAGCACACAAGATTACGAA
CACGATCATATAATACTCTCCAAACGAACGGCAGCTTACCTTGTTGGATGATCTGCTGATGCTGCATCAGAATGCTGAAGAGCTGTTCCATTGAGACTGG
GCCAGTAGGAGAGGCTGGGGCTTGAACCGGTGGCTACAAAATCTCGGTCAGTATAGTATTGTTGCAGCTACTAGCACCGAACAACTTACACCTGGATCAT
TGGGCGACACCTCGTCTGGACGATCGAGAAGATCCGGATCCACCTCTTCCCCCTTCATCTTGAGCTTGATCAGCTCGTCAGCCATGCCCATTTGTCGCAG
TTTGAAATATTTCTGAAACTTCGGGTCGTCTCGAACTTTAAGGGGGTCGTACGGGACAACGGGGGCCGCAGCGGGCATTGAAGGCCAGCTAAAGCCCCCG
TTTCCTTGCAGTGGAGACAGCGGTGCCATCCCATTGGACGAATACCCGGACGAGAATTGCATCGGAGGCTAGCAAGACACACGAAAGCTGTCAGAGAACC
TTCACGCGGTCGTTCTACTAGCACTCTAACAACTTACACCAGGGTCGTTCGGTGACACTTTGTTCGGAGTGTCCAGGAGTGTCGGATCCACGCCGTCAGC
CTCCATTTTCAGCATGATGTGGTCCTTTGACATGTTCATACTCTTCAACTTGAAGTATTTTGTGAACGCCGGGTCTTCCGCCACAGTCATCGGGGTGTAG
GCTCCCTTCTCCGGCTGATAGCAGTCAATAAACACCATGTTACACAAAAATTTACACTGCGAGACATAATAGTTCAGCGTACACCCGAGTCGTTGGGCGA
TATGGCATCGGGCGTGTCCAGTAGATCAGGACTAAAGCCGTCGGTCTTCATCTTCGCCTTGATCTGCTCAATCGGTATGTCCAAGCCCTTCAGTTTGAAA
TATTTTTTAAAATCCGGGTCGTCCTTCACCAGTAGCGGCGTGTACACACTAGCCACCGTCATCATACCTCCCGACTGAGACGCATAAGCCACGCTCTGTG
TCTTCGTCTCCAGCTCCGTGAGTTTCTGTTGCAGCGCCTTAATCTCCTTCAAACTAGCGCCAGAAGAGCCTCTTTCTCTTGTCACGGTAATCTTTTTGTC
TGCCATAAGTTGCGAGATTTGCTTTTGCAGTTTGTCAATAGACGAGCTCGTGCTGGCGGAATCGCTCTTTGTTGCCAAATCTAGCAGCTTTTTGATCTGA
TTGGGTGTAAGTCCAGGGACGGCGATGCCTCCACTGGCTTTGCGACCTACTGACAGCGGGGCGTGGGCCACATCTTCACTCTCCGAGTCGCTCTCGTCGT
CTTCTTCTTCCGATTCGTCCTCTTCCTCCTCCTCGGCCGCTTCTTTCTCCATCCTCATCTTTATGCAGAGGTTGCGGTGAGCACGAGCGTGTCTCCTCTT
GCACGTCTGCTCTCATCCATACATAGTTAGTGACCATTCATGTAAGTCTTAGTCTTATTCTCGTTTTTGTTTTTCACTTGCCTCGTTGCAGTAATAGGCT
TTGTTGCAGATGCTGCAGGACAGCGAGGCATTGGACGTCGCGCAGTAAGCGCAGTCCTCGCCCGAGCTGACCGCGAAGCCCATGCCCATGCTGGTCAGGC
GGCTCATGAGCTCATCGTCGCTGTCGCTGTCCGCCATGGTCAGCAGTCGATGTGATTGACTCGAGGCTTCTTGGACTCTGGGAACGTTGAATTCGCCAAA
AATACCATAAACGGGCCGGGTCATCGCATTATTGGCTGGTTGCTTTGACATTTTGATAGGCATCGACCTCGAAAAGCACGTGGAAATCCTCCGGGCTATT
AATTTTTGTTTATAAGTCTAACGAACGGGGCTTCTGTGCTTGGACGATCATTATTCTCTGGATCCACAAACTGCTTTACAGTTCGAGGAGCCGAGAGAAA
TGTCTTTGCTCTGATCTCTTGTGCATTTTCAGACGCAATTTGCCACTTCAACTTCCAAATGTTGCCAAACTCAGACGATAAAATCAAGTAAAATGAAATT
GCTCGTGGCTCTACTTCTGGAGGAATAATAAGTTATGTAGAGCGAGGCTATTTTTCCGCGTAGCTATAGGAAGCCTCTCGCCCTTCGATCGAACGTGGCT
GGCTCTGCTTTTATAGATAGGTTCCTTTTCGCCTAAGAAGAGGACTTGCGTCTTCCTCTAGGCTGCACGTGACAGTCGATGCTGTGAGAGCATGCGCACC
ATGTCTGGAGACTTGCCGGTCTCACTGATATTGAGCTTGTAGTCCGATCCCACATGCTCATTGGCGACAATGCCCGAGAACCGCTGGAACAACTCGCAGA
TAGTTGCGTGGCCATTAGCCTCAGCGATCATCATGGCATCACTGTCGTTTTTGGTGCGTTTCTCCGGGTCAGCATCGTGCCGTAGCAAGTACTCGGAGAT
GGCTAATGAGCCCAATTTTGCTGCAAAGTGCAGTGGGGTGATGCCACTAGCGGTCATGACATTCACGTTCGCGCCATGCTCGACGAGCATCGCTACGATC
TCGATATTTTCAGAGACTATAGCGGCGTGTAGAGGATAGGTGCCACGGTTGCTACAGACCGAAACCCTGGCGCCAGAGTCAAGGAGAAGCTTCACGACGT
CGACGCATCCATTGCGACACGCAGCGATCAGCGGAGTGACACCGGCGTCGTTGGCTTTACTGACGTCGGCACCTTCGTCCAGCAAGAGTGCAACAACGTC
TGTTCGACCAATTCGAGCTGCAATATGCAGACAAGAGGAGCCATCCGCCATGGCGGTGTTGGCATCCGCGTAGTTGAACAGAATGAGCTGCACGGCGTAC
GCGTGGCCGATTCGGCACGCCACGTACAGACAGATCTCCCAGCGACGCGTTGGGGAGAGGTCGGGCGAGTTCAGTTCATCGATGTCGCTTGCGAACTGAC
TCAGAACATGTTCACAGAACTCTTCCATGAACGAATGCATGGTGTGAACGCGCACAGGTTTCACCTGCAAAAATGGAAGTGTCACCAGTGCGTCGCTTAG
AGAAAGCGTGGGATCCTCTTCAATTCGAGGTTCGGCTGCGCGAGGGGCGACGAGATGATCGCTGTCGTCGAGAGCGCTGTCGTTTTCCTCCTCGTCTTGA
CGAAGCATCTGATCAGCACATTGTTGCCTCCAGGCGTTCAAGACCAGAGGACGATGTAACGCGACCGATGCGTCGGCTTGGAAATGTTCGGTAACACCTA
GGAAGTTCACATACGTCTTGAGCACCAAGCACTTGTCGTCCTGTAGCTTTTCATGTAGTACCGAACTGGCAAAATTGCTGAAGAATTCGTGTAAAATCGC
CACAACGGCTGCCAGACCGTTACGGCGTTCGTTGACTGCAGAATGGTCCAGTCCTGTGAACTTTGAGCGAAGCGAGCGGCGCGACGGGAACGGGAACGAC
TGCAGTACCGGGTACAGTCCGTCAAATTCGCAGCGCGTTTCAGCGCAACGGCATTTGTGCGCCGAGCCGGGCGTCAGGTGGCGGTGACGTCTCGTGTGTT
CGTTCACGTGCTTACGGAGTGTCTTCCACATGCGACGGAACTGCGAGTATGAGCGCAGCGTTGTGCATGTGACGTTGGATGAATGCGAAGTTGAGACTGG
CGCTTGAGGGTCATTGTTCTGGGTAAGCTTGATAGCAAAGAGCACCTTGCCATCGGTGACTTGGTAGGAGGGCACAGCTACATCGTACTTGTCGATCCAG
CTCATGGTCAAGTTCCTTTCACGAGAAAGTGTCGAGTTGGCGAGTGGGCTGGAGCTTTTTTGGTGGCTTCCGACGTGGGTGACGGAGACAAGTTTTTCGA
TAATCAGAAATGGATCGAAGTTTCTCGTAATAGATACCCCCGCTGACGGTAAATTTAACCACCAAGGAGGATTCTGCTTGTTGGGTTTTTTTTAGTACGA
GTCGACTGCAAGCAGTGCGACTGCGTGGATCCTTTCTCCGTTTGGAAAAATGGGGATTGGCGTCGGCTGTGAGTCTCCGTTCGCATGGGCAAGCACAGCG
GATCCATCGTCGTAATGTGGACCGAACATTTCGTGTCACACCCCTTGAAGTCTTTATCTGATGATCTACCAATCGTTAGGCGTCAAATCCTCTTTTTAGC
CAATCGTCACACGGTCCTACCTTCACAACTGAACGCAAAAAAATACGCTGTAAAGTCGTACAGTACCGGCTCTAGCGAAACGATAAACTTGGCTGGCATT
GAGCAGTGAAGCGGTCTCCGATGTTACTGCGGGGCACAAACCTGAGGTCATGGTGACAGGCCATCGCGACGCCACTGAGCGCGCCTGGCCGTGCAGTTTC
ACTCGACCATGGAACGACGTGCGCAATGGAGAAGACTACACTTCTGACTTTTCGTTCGAGCACCTTCGATGGTTCTAGATAAATTTGCAGCCGCAAGATC
GCGACGGTCGCTGATAAGACTTTCGGTGATGAAACCTGCAACCCACACGCAGACCGTAACCCTGGAAGGTACGTACATCTTAGCGGAAAGTTTTGGCTCG
GTACCAATTTGCAAAGGCTTTCGCGGATAAAACTACGGCTTAGGTGTAACATCGCAAACTCTTGACAGCCGATGGATTTTCGCAGCGTTCAACTCAAAGA
GCTTTGCTAAGATGTCAAATGTAGGGTCAGCTGGGTAGATAAGCGTTGCCAGCGGAGTTGAGGTAGATCACAGCCGCAAGTTTAGTGGAGAGGCCAGCAA
GTCTGTCCGATGCACCGTGTTGAGCTCCGGAGCCGTGAGCTGAGCCTGCAACATTTGCAGCGGGTCAAACTTCTTCTCGACAAGATGCTGGCGGTGCGCG
CCCCACGGATGGTCGCAATTGCAAACCCACGGACTATAGGCCCAACCGGATTTTTAGATAAACAACAACCCGAATTGTAAAATCGGCTTGCAAAAAATTG
CATCGACGTACGCACCTGTCAAATCCTTGACAGCCGCACTTGGGCCTTTTGCAGACAAATGGTTTGCTTCCCGGGTCGTGATTCGTGTGTCTATGTTTGC
AGCGGCATCGTAGGATCCAGGCGCCTTCCGCCACAACATAGAAGAAAGCTCTGCACGAACACCTGGCTGATGTACAGGCGAAAGCACGGAACCCTTTTGG
GGATTTCACTCGAGGGTCGCTGACACTACTCGGGTGCTCCTTGTATCGGTGTCCGCTGGGTATGTTATAAACAAAATAAGGAAGTTGCCAGTAAAGATCA
AGCAGTTCTAATATATACCAAAGACATCGGCTTTCCTCGCGAACGGGGATACATTCGCGCTTGCATGTGTCACAAGACCACTGAATGACCATCTTGGTGT
AGCTCTTCAACTTCATCGGAAACGGTGCCGGTGCGGTGCCGGCCAATGTCATAAGCTCGTTAGGCTGGTGCGCAATTGGTAACACGGCTTTTCCCTTTAG
CTCGGCAAACTCCTGCCTCAGTTCCACCACTGAAATCTCGTCCTGCTTGCAACTCGCCTGGGTAGTTGAAGTATCATCAAGACATGATATCTTCGTGTCT
TGAACCTTTCCACTGAACAAGTCCCTGGATGAACGCTTCACTTGCAATGCATGGTGACTTTGCTCAATCTGTCTTGCATCCATTTCTGGTTCTGTGGGGT
AGTTTCCTTCCTCTTGTTGGTTTGAAGTTAAGCCCTCGCAAGTTGCGGATATGCAGTGGTTCACCTTTGACCGTCTTCTTCGCAGCTTGCTTTTCAGTAG
TTGCAAGGACTGCGCTCGTGAAGCAGCATCCTGCTCCATCGTGATAGAAAAATGCGTCTCTTCAAGTGCACGGCCGTTTAGGATCTGACCGTACTCGCCC
CAATGGGAAACTTGGTACTACGAGTATCCTGCTGCATCATTGCCTTGATTCCCACAACCGAAGCGCTCGCTTGCAATGCTGGAGCGTATTTTGATGGAGC
CAAGTGTTTACCGTGTCCAGGAGGCACGTTTGGTGCCGTACCGGGCCTCGCCTCCTCGTCGTGCTCTGGGTTGTGCACCGCTGGGTTTTTCTGCCCAAAA
GGGTCGACTTCATCTCGAGAAAAGCTTTGCGGTGCTTCTACCTTTTACTGTCCCTCGGGTAGTGCAGAACGGCATCCCGTGGATGAAGGATACTACACAG
TCACTTTTCCTACCGATCAGTCTGACTTGCCTTCGAGTGCTGGAGAGCAAATACGCTGCGACAAAGGATACTATTGTGTGCTCGGGACCCGGAGAGCTTG
CCCTGCCGGTGTGTTTGGAGAGTCAACAAGAGTCACTACGCCAGAATGTTCAGCTTCATGTCCCAAAGGCTCTTACTGCCCGGAAGCTACAGTCGTGCCA
ATCCCGTGTCCTCCTGGAACCTACGGTGGCGAAATTGGTCTAACGAGTGCTCAGTGCAGTGGCCTCTGTCCAATTGGTCACTACTGGTACGTTCAAAGGC
TCGCTTTTGATCAGTACAAGCTAATTTTTTTCGCTGACTGCAGTACAATTGGGACGATCACTCCAGAGCCGTGTCCTTCAGGGACTTATGGGGCGACACC
AGGTCTCATCAGCTCAGCGTGCTCAAGTACATGCTCTACAGTCAATAAAGTGCTATCGTGTCTTCCATCACCCTGTCCAGCAGGATACTACTGCGCGCTC
GCGACTACAGTGCCACAAGAGTGTGGGTCAGTTGAGAAGTTTTGCCCTACAGGTTCGTCAGCGCCTACTACTGCTGCACCTGGCTACTATACCACTTGGA
AAGCGTACACTGGGACATCCGTCACCGGCGAACAGCTAGCACTGCAGTACGTTGAAGGGAACTCGCTTGCCATTCGAAACCAAACAACAAGATCAAACCA
ACATATCTGCGAAAAAGGTTCGTATTGCAGTGGCGGTGTCAAAAGACTTTGCCCAGCAGGAACCTATGGCGCAACTGATGGCTTGTCGACGGCTACATGC
ACTGCTCTATGTCCTGCTGGCTTCTACTGGTAAGGAAAAATCAATGTTACCAGATTTCTATGATCGTCAGCTGACTATGCTTGCAGTCCGTCAGGCACAG
CAGACTTTAGCCAGCACCCATGCACACTACGATCTTCCTTTTGTCGCCAAGGTTCTTCTGTACCAACCGCTGTCGACTCCGGGTACTTCACTGTAGCAAC
ACAAACAGGACTTCGAAGCGACGAAACCATTTGTCCACCGGGAAGCTTTTGCGTCGGCGGGGTCCAGTATCTTTGTCCTGAAGGCACATTTGGAGCCACT
TTCGGTCTTGCATCCAAAACGTGCTCCGGGGAATGTCAGGACGGATATGTCTGTCCACGAGGCTCAATAGCAGCACAGCAATCGCCGTGTCCGGCGGGGT
CATACTCTCGAAATGGCAAGTTCTGTGCACCTTGCTCTCCCGGTTACTGGTGCGACGCTGGGTCCCCAGATCCTCAGCAACACGCATGCGGTGCTGACAA
CGCGTACTGTCCGCTTGGGTCGTCTTCAGCTCAACCTGTTCAGGATGGTTACTACGCGGTGGGACAGCAAGTCACTACACACACGTCGGAGGCGTTGTGT
ACACCTCGAAACGCTTTTCATCTTCCACAGTGTCCAACAAGAACAGTAGGAGTCAA