Description :
From Genome Similarity Track
Location :
Scaffold_15:3269- 12181
Transcript NameFunction/comments
Phyag_g444hypothetical protein PHYSODRAFT_321690

Sequence
8912 bases(100 bases per row)
TCGAAGTCCCAGCGAGCTCCTTCCAGGATAAGGCCTTTAATGTAGGCACCATCTTTTGGACCCGTAGGAAGTGCATTCTCGCTCTGGTTCAGAACGATAA
ATTCCCAGTTGAGCGAGTCGATTGCCAAGCCGTTCTTGCGAGCTGCtgtctgaagaagagctgTGAGGAAACCTGTCGGGTAGGTGAAGCCGGTGAGCCA
GAAAACAGAAGGTTGGGCTTGGTTGGCCCACCGATCCATTTGCTCGCATCGGAGCTTCAGATCTTGTGTCCATGGGCCCAGTGGTTTGAGTGAGGGGTAG
CAGAAACTCCAGGCCTTGGGCACCGCGCCAATCAACAGCGCATTGTAGACGGCTTCGAGCTCAGGAGTAATCACCACGGAACCTTGGATACCTTTCTCAA
GAGCGCGAGCTGACGAGTTGATAGTGGCGAGAAGTTTGTTGTAtcgctcgagctcctgcaTGAGTACTGTCTTGAGTGCATCTGGGTCGCTTCGTGCGCT
CAAGCCAGCCTTGATATTAGCAAGATCAAACACATCGGGCACCGTTTCTCGCAGCGTCTGTAGCAATCCCAGCACCGTTTCAtcgttgccactgccaccT
TCAGCGACATCTAGTGCCTGCAGGGATAGAATCGTCGCCAAAAgttctcgtccatcgtcgATTTGTGAAGCAATCTGTGCATTGGGGTGCTGGCCAAACG
CAGCAGGTGGATCATCCAAAGGCAGCTGCCGAATGTACTCCGTGTACGAGGACAGTTCGCCGTCGTCTGGAACGAAATAGTACTCCGAGTCCGACAACGG
CATGTTGTCCACGGTGAGAACAGTCTCTGAGAAGAACTGTGAAATGTACACCAGCATAAGCCGGCGATCCCAGTCGTCTGTCACCCGGCCGCCATAGTTA
GCCTGCGCGATGAGATACTTGAGCGCATCCCAAGGTGTATCCTCGTATTCATCGAGGTAGATGGCCAACACGTCTTCGCTAATGGCGAAGTCCGACTCAT
TAAAGTCGTATGGAATATTCCAACCGAGGTTGTTGAACTTGcgacgctcgagcagcagcgagtggaaCCAGCACAAACAGAACAGCAGTCGTttgtactt
cttcacttGCCTGCAGCGTGCAAATTTCTCGGGCGTGATCGTATTGTACAAACGTATCAGGTTAGCCTTCAATCCACGCGGTGGTTCGGTAGTCATCTTG
ATTCCACGCTGCAAAATTGCGATGGGGAATTTCGGGTTCGGACTGCTTGTTAGCCACAATCGGAACTGCGGGTTAATCGGAcctgcaggagctggagccg
cTGCACAGAAGTTGTCGATGAGTTTTTCCAGCGTCGGCGCCCAGCTTAACATCAAGTGACAATTGGCTAGGAAGACCCAGTTTCCAGCATCTAGTCCGCG
TGACAGCATAGCCTCGGCAACACTGGCTTGACCCTGCCCCAGAGCGCAGTTCTCCACTGTTTTGTGCAGCGATTCGGCCAACGCTATCAGCGAATTTGTC
GGATCCACGCCAGGAGACAGCACGAAAATGAGTGGCGTCTTGTAATTTGACGTGTCGTAGATAGCCTTCAAGTCGAACGGTGGCGGGTCCACAAACTGAG
CTCCAAGATGTGTAGCTGTGAATCGAGCAGCTTGAATGCTGAGTCGATCAGGTCGGATGCAGCGGAGCAACAGCATTCTCTGCAACTCGTTGCATTTACC
CTCCCAGTCCCCTGGCAGTGCCTCAATTTCTGGTGTACTACTCTGGTACCACGACTTCCAGCCTTTCAATGTCTGCTCGAAGGAGCTGATGATGCCGTGG
AAAGCAGACAGTTTGTTGAGTTCAACAATGCTAGCCCAGGAACCATCCGAGAGAAAGTCATTTGCAACATTCGTcaccttttcttcttgtgccaAAACGT
TGCCACCTTTCAGCAAGAAATCGTACTCATCGTGAGGTAGCTTATTCACACTCCGCAGAACGGAAGCGCACAtctgcagcgagaacagcagcttgtggcg
CTCAAACAGTCCACGACAAGCGTAGGCATACACAGCGTACGTGTGGTAGTCGTTAATGGCGTTAATTCGTTCCGTGAGTTCCTCACTGAGAGCACCTTGG
TTCTTGAGACTTCGGCTCTTGACGATAGAATCCTGGAACAGGGCCACGTACGCATCCAACGAGAACTGGTACATTGGATCCACGCTTGTCATGTCGTTTA
GAACGAAATACAAGGTCGACGAACGCAGTGCCACCCGAGCGTATCCCATGCGCGCAGCGTctatcttcttctcggtctCTTCACTAATAACGAGCTGCAT
GGAGACCTCTTCAGACGTCGTCTTAGACGCATTCAGTGTCGTTACAAGTTGTTCATCGTCCAACAGTGAACCTTTTGCAGCTGATAGAAGGCGCAGGATC
TCGTTTTCGAGGTCAATAAGCTTCTtctttgctgcagccacacgCATGACGAGGTCGGACTTTTGCTCCTCTAGGGCTGGTTCCTCCAGCTGGACTGCAA
TACCGAGCAATTGCGCCTCGAGTCCCTGCTCCTTCACAACGAAGTTCACAATGGTCGTCTTTGTCGACACCTCAGGGGTGTAGTGAGGGTTGTggagctt
cgtcgtcagGTAGAAGCGGAACTCGCGATTGTAATCGAGCTCCTTATCACCGAGACGGAGTATCTCGCGGTTCCCCACCTTGATGATACTCTTTGTAAGT
ACTGGTTCAAGGCTAGGATCGAGCTCTTCCAAGATGTCCTGCATCAATACAGGTGAACCGAAGCGAATACCATTCTCCAGTTTCCGAAGTAGATCCTTCA
TCATTGGATCTACCACCTCGAGACGTGTTCCCTCCATCGCTTTAATCCACTTGTTAGCTTGGCCTTGAGGATCAATCATGAGTGGCCATCGCTTGCCTCG
TGTTGTGATCACGCCATTTTCAGTGGAGAGAGGATCGCGCGGAAGGCCGTGCGCATTCCAGCTGCGGACATCCGTCGGATCTGCCAAGAAATCGATGAAA
GTAAACTTGGGCGACAATGGCAACGCCTGTTGCGTCACACGATTCATCCACGTATCCACAAGCGAACCACGATAGAAAGTGTCGAACGGACCTGCGTACG
AAATGAAtgcggcggcgacaagtgCGTCACCAACAACATTCTGGAGGCTCGCGTTCTTGTCAGCAATAGATCCTTCCCAACGTTCACGCTCGCCAGCAAG
CCCCTTGACCAGTTGCTCAGCACGCGAGAGCTTCAATTCCAGCaattcagcttcttcacgcagcgCATTCTTCTCTGACACACTCGTATCGTACTGGTTT
TTCAGAGCCTCGACTTTTTCTGTaacctcctgcagcttctcctttGCTACCTGGAGGTCCTTCTGTTTCACGGCAAGCGCCTGTTGTGACTTtcgcagca
cctccttcttgggaGCGACAACACGGAACACCCCTGAGTAGCACTCCATTGCCAGCACCCATGAGCACagagctccagctgctgaTGACACCTTCCTCAC
CATATCAGCATTGAACGTTGGCTTCGATGTATATTTCTTGAGAGCTGTCACGGTCTTGTCACGAATTGAGTCCTTGTCGAATGTCTTAATTTGCTGCAGG
AAACTTACGTCATTCATCTTGGTCTTAGCTGAAGCCCACGTAGGCGGCAAGCCGAAAAGGATCATCACCGCGCACATAACCATCGAGACTGCCTCGGGTG
GCTGGGTGTACACCTTCACTTCAGCAATTGCTTTTTTGTCCAGATTTTCAACCTCCAACATCGCGCGTTgaagtgcaggaagagcCTCGTCCAAATCTTT
CTGTGCGTCATCAGCGATTTTCTTCGTTTCTGCCTCCTCTTTACCAATACGCTCACTATCAGCTTCGACCTGTTTCCGTTGCTCATCAGCGACGCGACGC
TCAGACACGATAACCACCAGCAAGTCACTACAGTCTTTATTCTTCTGAGCAACGACAATTTTCcgctgctcaagttgctTGGACATCTCTTCCACCTGCA
ATCGGGATTCTTCCAGCTTCGCTAGACCATTTTTGAGTTTATCGCGTGTGTCACggattgttgctgctttctcCGATAGCAGCTCCACATAGCCAGTGAC
GAGAGACAAATAGTTTGTCGGCGTCACGTAGTTGTGTCGTTTCATACGGGCCAGGACTTGCGACGATGCCAGCATTACGCTGCTGTGCACTACAGCAAAC
ACAGCTGCGATCTTAGGGCGCTGAGCTTCTACAGCAAcattcttctcctcgaggaACTTCATCCCAACTTCTTGAAGAGCATCCAAAGGCCACTCATTGA
ACCAGTCGATGTTAGTGTTGTTGACGAGGGATGGAAACTGTCGACATCGATTGCAAAAGCCTTTGCCAATCGGACTAAAGGCCAGGACGACGTGCAGATT
GCGTCGAACTTCGCTGATGAAAAAGCTCCAGAGAGATTCCTTCGTCTCACGAATCCCTTGAGCACGTGCACGTTGACGAACTCCATCGATAATACCCCCC
AATTCGTCTTTTTCGAATAGTCCAGGAATTTCACCGCTGCTTAACATGTTGTTGAGGTCCTCGACGAATGACTCGCTCTTGATCTGTGTGTCGCTGAACA
AGAAAACAGTTTTCTGTTGCTGGAGCCCCACTTGTGTATAGAGCTTTTTGATATCTTCATGGAATTCGAAACTGCGGTAGTTTTTGCCTACCTCGATCTG
GAACACCTTGAAGCCGCCCATAAAAGCAGAAAGTTTTGTCAGCGACTGGCGACCGCTCCCGCCAACACCTACGAGTAGCAAGTTGCCTCGCATCGTCATA
AGTTGCCGGTGGATGCGCAAAATGTGCATAAGTGCATCACTGAACATGACGAGATTCATTGGAACAAAGCCTGGCTCAGCATTGTgattctccagctgct
cttccacaaaactcttcagcagcttcatgtcCATGACTTCCGCGTACCGCGCGCTGCCTTCGTCAGCACCAGGAGTGGTGGAAAATATGTACGTGAACAG
CGGTCCATTTTCCTTCAGTTGTTCAGGTGCTGACGACAGTAAGCGACCCCAATCTGTCTGGAAGTGTACCCCCAACAGATCATCAAGCCTCCTTTTGAAA
GTTTGCCGGTCTTCATAGCTGGTGAGACGATCAGAGAATACCCGAAGACTTTCGTGCATCCACAGCCTCAGCATACCATCGCGACTGGTTACGTTGTGCT
TGTCGGAGAGCAAAAGTCCTTGGATCACTCGGGCCATATCACGTAAGTTGAATAGATAATGGCAATTCGCAGGAGTGGGGAGGAATTGCTCCAGAACATT
TTGGTACAGTTGGATGGTCGCAGCCACAAGAGGTACACCTAGCGGTTTGatttcgtcgtcgaactccgATAACTTGGGCACGAGCATGGTTTCAAATATA
CGCTTCAGTTGGGCTTGCTCTGGGATCGTCATATTGATTAGGTTGAAGCGGCTCTGGAAGCGGGAGCTGATGACCGATCGCCCGCCACCCGGAGGCCCCA
TTGCAGCAATAAACTGCATGTCGATGAAGTACTTGAGCGTCTGCTTTTTGCGGTCGTACCAGCAGCTGTAGTCCACCCACTGTCGtaacagctccagcgg
cggctGAGATCCAAACAAATCCTTTGTTGGCATGTTCATGTCGTCGATAAAAGTAACTAACTTCTTGCCACCCACAGGACCAAACCGATTCAGTGAACGC
TTCTCCATTACGTTTTCAATCATATCCTGCGTCGTTGCAGACGAAGTAgcagacgagaaattcatCACCAGTACGTTGTACGCATCACTAAGAGCCTCGA
TTTCTCGCTCAATGACAGTTGTCTTTCCCACGCCAGTTTCACCCACGAGTAGCGTGTGAATACCAGCCGTGAGCATAGTCTGAAGTAGGAAACCATACCG
CAAAGTGTCAATCGTGGGCACCATGATCTTGTGAAACGGCGTGTTAGGCGCAATACGAAAGTTTGGCGGTAACTTCTCGTCCCACAACTTGAATTCGCGG
CTTGAAGGCTCCACAAAAAAGTCGTACGCAGTTTTGAGAGGAGGGTAGACCGAGTCAATGTCGCGCAGGAAGAAGTCAAATTTTTTGCGCCCTTCCTCGT
TCGCGGCAGCCATAACGCTCCAAGTCATGCAAAATAGGAACCATTTTTCAACTGCGACGGCAAATTTGTCGCCGCATGTGGCTAAGTCCACGCCGTTGTC
TGCTGTTGCTAGCGCATTGTACAGGTTGCAAAAGGACTTGACGCTGTTGAACGTAGTCACGGGGATGAGCTCTGTCACCTCGGATGTTTTAAATCGCAGA
ACCTTTTCCATGTACTTGTCAAATAGCGCCTGGAGCACATCACGTTCTTCCTGGACTTGAATTGTCGTAGTTAGCCACGTTTGGATGAAAGGGCGCCAAC
CAAGGTCTTCGACGTCCATGTACACCATACCAGCACGACTTACAGTAGCGGGGGACGCGACTGCTAGGTCCTGCACCTCGAACATGAGTGCCATTGACGG
GCTCATGCTAATACGATCACCATTAATGAGCGTCAGTACTTTGTTGTCATCCATAACACTGTTCATACTCTCAATCCACAGTGTGTCAACTGGCCCATCC
AGCATAATCCACTTCTCTTCAGCTTTCTCATCCGCTGCCAAGTTTCGAAAGATAGCGGACAATATACCGTCGATCCACTCGAACGTTGACAGGTCGTAGA
CGCCGTAAATCTCGTTTAACGAAATAGACTTCGGGTTCAGCACCTGTACCCGCACTGGCATGTATCCAGCCACGCCATCTTTTGCCAGCGACGTCTTTGC
AGCCATAAGAGTCTTCCAGATTGTGGTCTTTCCGGCCATTGTCTGACCCACAATCATATTACAATGGCGAGTCACCTGGGATTCGTATAGCTGGATCGTC
TTGAATACAATCACCGGGTGCACTTGCAGCTTGCTTTCCAACAGTGCCTGCTCAATGTTGCCCTGCAATTTCCCGTAGTCTGTTACGGGAAGTTCGATCG
ACGGAAACAGGtctccaagcagcaagcgaAAAAGCACTGCATCTTCTCGGATGAACTTCGGCATATTCATATCACGCAGTGCTCGTAACAAAATGTTTTC
CTCCTGCAGGTTGGGATCTTCGCGCTTTAGAGTGCCTGCCATGTTTAGCACAGCCTTTAAACTACGGAGTCCAAAGTCATAGTGATCCTGTTTGCTCAGT
TGCTGAATCATCAACCCGTAAAGTGTCGTTGTTTTCTTTGCTAGAATCTTCGCATCACGGAAACCTTCAGCCTGAAGCATGACCTCCGCAATTAGTGCCA
GATCAGGTACCATCATTGCGCAAGGGCGCATCAAGGCTTTGAGATTGTCGGGGAGTTCTGTGCGACCAGCATAACCCGGGTTCATCGTGATAAAGATAcc
catgttgaagttgacctTCATCAGGGAACCGAGGAACATGACCTGTGTCTGCCTAGCAGTCAGCGCCTGCATAATCGTCAAAacctgctgcgccacgaCG
GAAAGCACCTCAATCTCAATACGGTTGAACTCATCGAAACAACCCCAGCCGCCAGACTGAACGAGTCCAGCAAACATTCGCCCAACAGACTTGTAATCTA
AACcatcgctgcagttgaaCACAATGACGTACTTTGCCAAATTCTTGCCCAAATCCTTGACAGTCTCGGTCTTTCCTGTTCCGGCAGGGCCAAGTGGATT
GCCACCCCTGTTCAGGTGTAATGCTGTTGTCATGGTGAGAACGCATCGATCCGTCAGTGGTGTGATCACAAGCCGCCCGTTATTGCCCTGATATTCGTAG
GAGTATTGCAACGAGGTGACCGTCTGCTTAACCTCGCAAATGCCTGATTCACCCAAATCCTTGTTGAAGTAGAAACGTAGCTGCATCAACCAGTCGAAGT
CATTCACACTTTTACAGTTCTGTTTGACCAAGCGATCAATGACGTCTCGCGAGTGAATTTCAATTGTGATCAGTGCCACAACTTTCTTCCGATCTGTCGC
TGAGAGCTGACCACGCACCATGTCAGCGAGTTTGTTCAGATACGAAATCCACTTTTTCTTTAGCTGTCTCAAtgccttcttctctcctTTTGCCACCTCA
TTCAATGCCTTAATGCACTCATTCGTCCAGGCTGTCTGCCCACACGTGATTAATAGCTGGCCCGGAAAATCTTTGATCcatttctccttcttgcccttgt
agCCCACAATGCATTGCGCAAAAATCTTCTCCAACGTGTTGACCATGGCGGCTTCAACCCGTAGTAACCACCCCTCTACAGCGCCAGCGACCACCACATT
CGATGCAAACATCACTTGCTCACCGCACGGTGAGTTCATTCCCAGGGCCTCGAATGTCGTATTTCCGCGAGCACCAGGCGGGATCAGGTTCAGCGTCTTG
ATTGCCTCAAAGCACTTTTTGATATGCTTCTGTACTTGGTCTGGGTCCTTTTGGTGCCCTAAAATTTCAAGCAGATCGTCATTTGAAAGGAAGTAGAATC
GTGGAAACAGCATTCGCTTTGTTTCCAGATATTGATCCAGACATTTTTGAATCTgatccagcttctcctgcatcgTGACCAACGTCTGCAGCACACCCGT
TTCCTGCGTAGCTTGCAGCGCATTCTTGGTCTTAGCCATCCCTTCCGTCACTTGACAGTAGGCAGTGTTAACCTCGTCAAAAAGTTGGCTTTCCAATGGC
AACTGCTTGCGGATATCCTCGGACGCCATGAAGATACTTTCCAGATATATCCAACAGCGCTGCACACCTAGTAGGGTTTCAATAACTTCCGAGAGATGAG
AGAGAGACTTCTCCCAGTACAGAATCCGCGTGTCGAAAGACCCAAAGAACGGCGATGCCTTCATCGTTGACAGCTGCacttgatcatcttcgagtGCTGT
GAACAGGTCATC