Description :
From Genome Similarity Track
Location :
contig_40:326888- 331063
Transcript NameFunction/comments
g7375.t1hypothetical protein
g7376.t1hypothetical protein PHYSODRAFT_495040

Sequence
4175 bases(100 bases per row)
TCCGTTGGCCCAGAGAGTTTGTACAACTGGATGGTGAGTGAGCCGAAGAAGCGAATGGCATCCTGTGACATTGGTGTCATTGACACTGCGAAGGAAATTG
GCCGTAATATTACGCATTTGGTCATCTATCTCGGTAAAATACCGCAACCAATCGAAAAGATACAGCATACAAACGCCAAGTTATTCGACGCCCCCTCGCT
TGCACGAAATCATTCCGGAAGACTAACGTGGGGACACTCCCCGAAGCAAAGAGCTCCCGACTGCAGGCCCCAGAGAAGCGAGCCACGATGGACCGCCTCG
CGATCGACAAGCTTAAGAACGTCATGGACGAAGCGTACGTCCCCTCACCCCCCTCTCTCCCCTGCGAGTTATTGGCACAGTTCTGCTGACGTAGATCTTC
CTTGTGCTCTCTATCTGTAGGAAGAGCGCCGTGAAGGCCAAGATGGGAACCGACGTGGAGCGCAAGATGGAGGAGGCGCTGTCCAACAAGAACTGGGGCG
TCCAGCACGCTGCTCAACGAGATCTCGCAGCTCACCTACGACTAGTGCGCAGCGTTCGATGTTCACAATTTGCTACTGTGCTGGTATACTCATGTAGTGT
TGCTGCTCTTGAATTGTAGCGAGGCGTACGGCGTCGTCATGCGCAAGATCTGGGAGGCGCTGGACGCCGAGGGACGCCAGTGGCGTGCCGTGTACAAGGC
GCTGAGTCTGCTGGAGCACCTGATCAAGAACGGCACGGAGCGCGTGATCGAGAACGCACGCGACCACATGTTCAAGCTGCGCCACCTCTCGGGCTTCTCG
TACCACGATGGAGCTGTGGACAGGGGCAATGGAGGTGGGAACCTTAAGATTTTGGGCTGCAAGAGCCTAGAGTTGCTGACTTTTTTGTTGCAGTCCGGGA
CAAGGCCAAGCAGTTGGTGGACATGCTGAACGACAACGAGATGATCCGCACGGAGCGCGAGAAGGCGGGACGTCTTCGCAACAAGTATGTAGGCATTGGA
AGCGGCGTTGGCGGTGGAATGGGCGGCGGCTATAGTGGCAGTAACAGCTACAGCGGAGGAGGTGGGGTGGCTACAGTGGAGGAGGTGGCTACAGTGGTGG
TGGTGGTAGCGGCGGTGGTAGCAACAGCTACAGTGGTGGTGGTGGTGGCGGCGGTGGCAGTAGCTACAGTGGTGGTGGCAGCACGAGCTACAGCGGCGGT
GGTGGTTTAGTGGCGGTGGCAGCAGAGGCTACGGCGACAATGACTCGAAAAACTACCAGGAGAAGGAGAAGGGCTACTCGAGCCGCTACGCTGATGACGA
CCGCGGTGAGTAGCCACAAAAATGACGCTATTGAATGAACCACTAACGTAGAACTCTCTTCCTAACAGATGACGGAAGCGAAGAATCTGAATCGGAGGAG
GAAGTGCGCTCCAAGCGACGGACAGCGTCATCTAAGCGTAAGGCTGCGGCGAAGAAGAAAGAGGTACTCGGGAGTGCATTTCTTGTTGGGTTGTGTAATT
TATACCAAACCTAAACTGGTCGATTTTGAATTTACAGGAAACCGAAGCCAAGCCAGCTACGAAGACACCCTCCGCGCAGCCGTCCCTCCTCGACAGTGAC
TTCTTCAGTGCTGCTCCCGCGGCAGGTATGAATGCTTTTTTTGTACTGATGATGGCTGCTTGATTCGGTTTACTAAAACATTGCTATAGCTTCTCCTGCA
GTGAATACATTGACCCCTTCGCACCAGCACCTGCGGCCCCCGCGGCTGCACCTCAAGCGGCTTCATTTGCGGCGTTTGGAAACGCTGCGACCGCACCTCA
GCAGTCGTTTAATGCTTTCGGTACGCCGCAGCCGCAGCAACAGCAAGCTTCGTTTGATGCTTTCGGAAACGCTACACCAGCCCAAGGCAACGCTCAACAG
TTCGCTGCATTCCCCGCTGCGCCAGCTCAGCACGGCTTCAATGCCTTCGGCCAGCAAGGTAACGCCGCTGCTCCTCCCGCTCCTGCTTTCAACCAGCAAC
AGCAGTTTGGCCAGTTCGGTGGCATGCAAGGAGGCATGCAGCAGCCTATGCAGGGTGGTATGCAGAGTGGTATGGGCATGCAGGGTGCTCAAAGCCGAAC
GTCTTCCAATCCTGGTGCCAACCAGGCACGAACGAACTCGGGTCCGAAGCCGGATGAAAAGAAGAACAACGATGCGTGGGGTGCTGGCTCGTCGCTATTT
GATCTCAACAATTTGTCCAGTTCTACCGGAAGCAACGCAAGTAATGCAGGCCGTCCTGGTCAGCAGCAACAGCAGCAGCAGCAGCATCAGTCCAATGCGG
GCCGCAACAGCTTCAGTGGCCTGGACACTCTTGCTGGGATGCCCAGCAAGCCGATGGCGGTGGCGGTGGCATGAACCCTATGGGCATGGGTGGAATGAAC
TACGGCGGCGGCATGGGCCAGGGTGGCATGCAGCAGCCCGGAGGCATGGCGTACGGACAAATGCAGATGGGTGCCATGGGCGGAATGCAGCCCCGCCCCA
TGATGGGGGTATGGGCATGCAGCAGCCAGGCATGGGTATGCAGCAGCCTGGCATGGGAGGCATGATGAACCAGGGTGGTTTTGGCGGCATGAATGTGATG
CAGCAGCAGCAACAACAGCAGCAGCAGCAACAGCAGCAGCAACAGCAGCAGCAACGACAGCAGCAGCAGGCGTTCGGCTCATTTGGCAACTTTAGCTGAA
GAGAACTGGTTGGCGCTACAGTCTCGACGCAAGAAGACGAGCAGGTGTCAAGTTTGCCGATAATACATGGTAAACACGGGTGTGGCAAGTTGATGCCTAC
CGTCCAAACAACTAGACGAAGAGACTTCAACTGCTAAGAAGAAGCCGCAGTGCTTCTGCAGAATGGATGATATACGTGTGCGAGAGCTGCAGCGTCAACA
GTCCGAGCATGTTGTTTGCCACTTTTTCGTGCGCTTTGAGTTGTATCCAAAACGCCTCAATTGAAAGCCTTCTCACCACTGCAGTGACTGATGACACGAT
GCAGCGGTGAGAGGTGGTAATGGAGGAGACATGTATGCACACTTGCACTAGCACTAACAGCTCCCTCCTCATGTCTTCCTCAAAAAGATGCAACACTCGA
TAGCATCTTTGTCGAACTCTGCGAGCCGCGCGAACTACCGCATTCGTCAGCGGTAAAATCTTGTCGCTGTACCTCCAGCAACAACAGCCTGGGAGGAAGT
GACGCATTCCAGCTACTCGCCACACTGTACGTTGTCCAGCTCGCTCAGCGTCGTTAGCTACATAGCCAGCTGGGCCAGTATCTAGTCGAAAAAGAAGTTC
CTTTGCTCCTTCAAGAACACGCCGAAAGTCGCCCATGCTTGTTTCCAAACAGTGCGTTCTGCGGGGACTGCGGCTGCGTCGTACAAGCGTCCTCCATCTC
CTGGTCCTGCTCGAGTCTCTGTCTAGCTGAATGTCTGGAACAAATCTCCACTGGCACTACTACTCCGTGACAATTTGCCCGAGGACGTGGCCAAGATGTT
GATCTGACTCGACGTTTTCTTGAGACTCACGCGCTGCTCGTCTCCGTCCTCTGCTGTGTCCACGTGGACCGATTTCCGTTTCCTCAGTCCTTCCGGGTAC
TTGTTGAGCACACTAAAAGGCGACATGACGCGTAAATGTCCAGGTATCGACAGTCTAGCGGGAGGACTTCGTTTCTGGCCTCTGGCGAACGCACTTGGAG
GCGGAGAGTGGACGGCATTGTCCTCCTCCATGGGCGTGATCTCCACCTCGTCCACACTCACCATGGTCTCGAGTCCTCCGTCGTCGCCCTCGGAACTGGC
TCTTCTCTGTATCCTGGTGCTCGCCGCCTGCTGCTTGCGCCTCAGCTGCTTCCTCAACACGTCGCGTGGTTGCGGAGACGACGGCGGCGTGCTCGGGCGC
TCGGCGGGAGCAGCTGCAGCACCTTAAAGTGTTCGTTGGTGGCTCCACTGCTGCGTCTGTCGGCCTCCGCCTCCTCCGCGGCGGCTGTCGTCGCATCGTG
GTGACGCCCCACGGCGATGCGCGTGAGCTTCTCGCGCAGCAAGACCATGTCTTCGTGGTCGCTGACGAGCGAGTTGCGTCGCAACTTGGAGTTGATGTTC
ACGGCGGCGTCGGGCGTCAGCGCGCGGCTCTTGGGGCACAGGTTGGGGCTGGACGGAGACATCATGGCGGGGAGA