Description :
From Genome Similarity Track
Location :
Scaffold_33:326877- 328011
Transcript NameFunction/comments
g5246.t1hypothetical protein

Sequence
1134 bases(100 bases per row)
GGCAATTAGAGAGTCGACGACAGATCGGGCACACAAACTCCATGTCGCGCTCACTGAGAAGCCGATCCTCACCAGTAGTCGTTTCCAAAGGACCACGACC
GTGCTTTTGCTTCCACAACGACATCAGGTATGCCTTTAAGCACGAGTGGTGGATTGCATGGCCGCAGCTCCAGATCACAGAGTCCGCAAGCTGCATCCGC
ATTTCATCGGTAGTCCCCGGCTTCAGCACGCGCAGTGAAGGTAATCGCGACGAAACCACAGGACGCCCATCCGAGCTTGCAGCACTCGATGAGCCTTTCT
CGATTTTCTGCGGCATGTTCGTCGGTAGGATCATACCCACAAAGCCAAACGTCGAGTCGCGGGAACGCGCATCGCATGGCAAACGACAAAGGCCACATTC
TTCAGCTTGAGTGGACTGTTCGTCTAGTGAGGCGTAGTCGTAGCTTATAGAAGACGAACGCTCCCTTTCGTCATGCTCAGCGGTGATTGACGAGCTTCTG
GTACTCCGTCTCCGTCGGCGTCTTCGGTCTTGAGTTTTCCGCTGTTTATCCCGCATCTGGGCGATTGCCGAAGAAACATGGTCCAGATACAGGCGCACAT
CTACCTGACCAGTTGGAAACCCCCACTCGTCTTCCTCTTCTTCGTGGTCCTCCTCCACATCCTCTTCGGATTTCATTGATTCATCGTAGCTATCGCTATC
TGAATCCATATCCGCGTTATGACCTCCAGCATTATCGCGAGTATTTTCATTTCCTTCGTCGTCAACTGGGTCACCATTAGCGGACAGAAATTGCATCTGC
TGTGACCGCATCTTCTCCAGTATTTGTTGCTGCCGCTTCCGCATCATCTCTTTTGCTGTGGGTTTTGGGGTTTCGTCGACTTTGGTGGCTCGATTAGAGC
CATTTGGACCAGAAGCATCGCTCCCCGTTTTCGTATCAGACTTTGCATCGAGGTGTTTGCGCTTCAAGTCATCCAAATACGCTGCACAGGTTGACGATTT
CTCGCGTACCGATCGTAGGATAAGGTTCACCACTGGCCGAGTGTCCTCCATCGCACGTCTGTGTTCAGTGAAGAAGAGCAGCAACGACAGCAGACTAGAA
GGTGTTGTTTCTTTCTCAGCACGCTTTGGGCTTG