Description :
From Genome Similarity Track
Location :
Scaffold_182:32686- 34676
Transcript NameFunction/comments
Albla_Nc14092900protein pelota putative
Albla_Nc14092910trafficking protein particle complex subunit 2like protein putative

Sequence
1990 bases(100 bases per row)
ATGAAATTGCTAAAACGTCAAATTAGTGAGAAAGATGGAGCAGGTCAAGTCGTCCTTATTGCGGAAGAATCCGAAGATATGTGGCACATCTATAATCTTG
TTCAAGTGTCCGATTCGATCAAAACTTCAACCATAAGAAAAGTCGCCAATCTTTGTATATTTACCAGTGAAAACGCCAAACATTGCATGCACATAGGTTG
TAAAGGAAGGCGCAACAGGGTCCACATCCAGCCAACGCGTACGCATGAATCTTCAGATACAAGTGAGCTATCTCTCGTTCTAAGGCGATGGATTCGATAT
TTGACACAATCTTCTGGCAGATTGAAGAATTCCATTTTGACCCAACACAATGCGCACTTCGTATCAAAGGGAAGAATACAATGGAAAATCCTCATGTTCG
CGTAGGTGATGATCAGATATATAAGATAAATTATCATCAGCAAGGCTATTTCGATGTAGATGGGCGCCTACCACACGTTGGATCTGGAAATGAATCAAAA
GTTCACGTTGACAAAGCAGTGCTGGGATCTCATGTCATTGGAGCGCATCGATTTGGCATGTAATATCTCTAAAACTGCTGAACTTGGCGCTGTGGTTATG
GAACTTGGTCTAGCTCATTTATGTCTGATTAAAAGCCACATGACAGTTATAAAAGCCCGGGTAGAGACCAATATTGCAAAGAAACGAACTGGTAGTTCTG
CACATGGAAAGTGCGTCAGCAAATTCTACGAAAATGTCATGCAAGCAATCAAGCGGCATTTTGATTTCAGTCTTCTCAAATGTGTCATCCTTGCCAGCCC
AGGATTCGTCAAGGAAGATTTTCACAAGTTTTTGATGGAACAGGCTGTACGACAGGATGACAAAATACTGCTAGAAAATAAGAGCAAATTTATATTATGC
CACTCGTCATCAGGACACAAGCACGCTCTGGATGAAGTTCTAAACGACGCTGTACGTGTGACCTACCGGAATGTTGTCAAATGGTGCATCAGTGTTTAAT
TCCGTTGTGCATTAGGCTGTATTATCTCAAGTAGCGGATACGAATGCTGTAGAAGATGTCAAGTGTTTGGATACATTCTTCAAGATGCTTCATGAAGACC
AAGACCGAGCGTATTATGGGTACAAACATATCTTGAAAGCGGATGAGCACATGGCTATTGAGACTCTCATGATCACTGATGAGTTGTTCAGATCACAAGA
CATCAAAACTCGAAAAAACTATATCGATCTCGTTGAGAGTGTGAGGGACCATGGCGGCAATGTACAGCTGTTTAGTAGTATGCACATCTCTGGTGAAAAG
CTTGGACAAATAAGCGGAGTCGCTGCTATTTTACGGTATCCTTTGCCAGAATTGGACGATTCGGAAAATGATTCTGAAGATGAAGAGAAAACGACTTTGG
ACAATGACAATTTGCAGGGGTAATTGTACACTAATACGACCTCATTAGTAACTTGATAACACTTGTACAATCAAACCGATGAAGCGATGGCGTTTGGCGA
TGCTGCTGCTTGCGATGCCAATGAAGCTGATGGATGACTACTCTGGTGTGTGTTGTGGTTCTGCGCTACCAAGTTACACAATCCTTTTTCAAATTCTGCT
GATGAAATGCATTCTCCAATCGGCGTGAAAGGATTCGAAATGACGTCCACGTAAAGTTTATGAACTTGCTCAAGAAACTAAACATAAAAGACCTGAAGAA
CAATAATATTGATTCCCAATAAAGCGGTCGAACCGTTCGGATTTCCGAGTCACGTGCTGGTTGCTGCTGCAATACGGCAATGAGTTTGATGTTTGTATTG
GCTATGTAGCCATAAACGCGATAGTCTTCCACTGGGGAAAGAAATCCAAGGTACATTTCATGCTTTACGGCAATTGCAGTCCAAGCGCGGAGCTTCTCTT
CCACCAGATCCAATGAGACGTGGACAATGTGATGAAACGTCAAATCCTCATCCTCATCAAACGTGCGTAGATATAAAGGGTTATTCTACA