Description :
From Genome Similarity Track
Location :
Scaffold_1083:3268- 6378
Sequence
3110 bases(100 bases per row)
TCCTCCCATCGACATGACCAACTCACATCCATGAGTCCCCTCACTACTCTTCTTCATGAGACTGCATCACGCCGAATCTGTTACGATTCGTACGATCCCT
CAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCTACCCAACTGGGTTCGTCATATCCACGCCAATACACCAGAAATTCACGGTAAATC
CGTCCGTATCTAGTTCGCTTCCCCGACCTCATATCGGTGATCTTCTCGACTTCGAACTCGTCGGCTTCGAGATCCACATTTCAACTATCTTCCGGTAGGA
GGACTTCGTCGAAATCCACCCGGTCGGATTCATCCACCGAAAGACGGATCTGCGGCCGATCCGGGTATTCTTTGACCGACTTCAGCTTGGATACGTGTAC
TACAGGGAACAGGCGATATTCGGTACCTGCCGTATCCAGCTTTACCGCATGTTCTCCAATCTTCTCGCTCACCCGGAACGGTCCATGCCATAGATGGGCC
AATTTGCGGGCGTATCCTTCTTTCACTCGATCCAAATAAAGCCACACCTGCGATCCCACTTGGATTTGATGTGGACGGGCGTCTTCGTTGTGTCGATCCG
CTCGATTCTGTATCGCACTCCGCAGTCGTTCGTTCACCGGGGATCTAGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTC
TCTCTTCTTGGTGCTGCATACTGGGATGGCCGCTTCCAGGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGGGTATCACCCCGGATCCTGTCT
TGGGCGGTGTTTATCGCGAAGGGGAGTCGTTCTGCGTACTCATCCCAATCCCTCTGATCCAAATCCTGGACATACATCTTGAGTGCTCTCGTGATCGTCT
GCACCATGCGCTCGGCCGACCCGTTAGCTTGGGGACGATATGCAATGGCTGCTCGCTGTCGCTGCCCCAGGATCCGGTTGAATGCTCGAAAGAAATCAGA
CATAAAGCCTAGCTCCCGATCATGTCTAATCATTTCGCTAGCTCCAAATCTTCGGAAAACACACTCCTCGTACGATTCAGCAATGGTTTGCGCAGTTCTA
GACGCACTAGCTTTGGCTATCACGTATCCGGTAAACAGGTCCACCCAAATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATAAT
CCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGATATTCCCAGGTGACTCCCCTTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATCCACACATTC
GCGACATATCGTTGCACACCCTTGAATAGTCCCCTCCAGTGGAAACATTCCCGTATCCGTTGGTAGGTCCGACCAATCCCTTGATGTCCACCTTCTAGAC
TAGCGTGATAGTGATGTAAGACATCCTGTTGTAAGATTTCCGGCACCACCAGTCTCATCAATCCATCCCGATCCTCGTTGACTCTCTTCGTAGGGGGACA
ATAGAAGAGCAAGTCATTCAGATCCACTGCATAATTGGTATCGATAATACTGTAGGATTTGGTATCCTCCCGACTAAGGTCTCGTACATCCCCCATCAGA
TACTTCTTTAGTCCCACGATCCACACTTCTTCGTTCTGTGCTTTGAGGATCCGCGCAATGCGGACACAAATGCTTCGTCGAGACTCTGGGGGCTGGATCC
AATCCTTCATCTGGATCCAGTGACGGCCATTACCCGGACTGTCATTTTTTCGGATCCAACCACCACCACCTCGTCTAGTCGGTTCAGCGTGACGAGATCC
TGATGCTCGGCCTCTGTCTCCACCTCGACACCACATTGATTCCGTAAAGCGGCACTGGCCAAGCTATCTGCACTGGCATTCCAATCTCGCTTGACATGCA
CCAACTCGTGATTCAACCAACCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCT
GATCACCAAGTTTAAATTGCCACAAATAACCAGCCTTTTTGAATCCTGTCCCTTTAGTAGATCAAAACCCAGCAGGAGCCCGTTATACTCTGCTTCATTG
ACGGTGAGGCCTTCCGCGTAAGTGGATCTGGCCCGTACAACCTCTATCCGGGCAGTCTCCACAGTATTGCGCTGTATGCCCCTCCTCCGCGTCGTACGCG
AGCGGATCCATCGAAACTCAGGACGTACAGATCCTCATCCATCTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGATC
CTAGTCAGCGCTTCATCCATCGTAGCTCGAGGTGTGATGCTCGCGGCCAAGCCTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTCCAGTG
TCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTTGAACAGCCAAACTAGCGTAGAGTGTCGAGTCAGGATCCGGAT
GGATCTTCCCACCAGCAGGTTGTAATTGAGATCCAACACGCGCAAGAGCGCGAGTATCTCCTTCTCCACCGCTCCGTAGTTCAGTTCATTTGGCTTTAGC
GTCCGGCTGACGAAGGTGACCGGATGACAGATCCCCTCATGTTCTTGTACCAAGACTGCTAAGACTGCCCAGTCACTGGCATAAACTATAACCGTAGGTT
GACGTTCCGAAACGAAATGACGGAGGATGGGTGTGGTCGCGGTCCTGTTCCTCAGCTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGGTTCCACCTT
TTCCGAGTTTTGATCCGTCGTCTCTATCCAGATTGGATCCTCTTCCCGTTGGATCCAGCTCCTGTTTAGGTCCTCTTCTGGCGTCGTACTACTTGGATCC
CTTCGTGGGTCCGACATCTCCTGGACCAGGGCTTGTTGGATTTTGATTTGGACAGCCGAAGTGGCCATCGCAGCGAAATCTACTTCTCTCAATTCATACA
GTACCACAGCAAACCGTGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAAGATTGCATCGCCCGTAACGACTGCGGGAAGGACAA
ATCGGCTAAC