Description :
From Genome Similarity Track
Location :
contig_62:3266- 7371
Transcript NameFunction/comments
g9223.t1hypothetical protein

Sequence
4105 bases(100 bases per row)
ATACATCCCACTCCTCCAAAACTGCAGCCTTCCTGCAGTTCCTTCTTCAATTTCCCCGGCGTGGCCAACCCACACCAACGAGTCCCGCCTCACTATTCTT
CGTGAGACTGCATCACACCAAATCGGTTGTGATTCGCGCGATCCCGTAGGAACTCATGTAACAACGCACCACAGTTGAGATCCGCTTCATCGATCCAGCT
GGGCTCCTCATATCCACGCCAGTGTACTAAGAATTCACGATAGATCCGTCCATATCTCGTACGTTTGCCGGACCTCAGATCCGTGATCTTCTCGACTTCG
TATTCATCGGATCCAAGATCCGAGATCCAACTATCTTCCGGTAATAGCGCTTCATCGAAATCTAGCCGATCTACATTGTCCACAACCAGCTGAACGAGCG
GGCGATCTGGGAATTCCTTCACCAACTTCAATTTCGATACATGTACCACCGGGAACAAACGGTAATCCGTTCCGGCAGTTTCGAGCTTGACCGCGTACTC
ATGGATTTTCTCTGCCACTCGAAATGGCCCGTGCCACAAGTGCGCCAACTTACGGGCGTAACCTTCTTTCACGCGATCCAGGTATAGCCAGACGCGAGAT
CCAGCTTCTATCGGGTGGGGTCGGACGTCGTCATTGTGCGAATCTGCTCGATCTGCGATCGCCTCACGGAGCTTTTCGTTGACTTGTTCTCGGACCCGCG
TATAATAACGCTGGATCCGGTAGCGCCATCGGCGTGGATCACGATCTTGACGTCGGTACTACCCACCGGGATCGTGGCCTCTAATGTAGATCTAGGATCC
CACCCATGTACCAAATAGAAAGGCGTATCACCTCGGATCCGATCTTGGGCTGTGTTAAGGGCAAACGTAAGCCGCTCGGCGTACTCGTCCCAATCCTGTT
GATCCAGATCCTGGACATGCATCTTGAGTGCGCGCGTGATCGTTTGAACCATGCGCTCCGCCGTCCCATTCGCTTGCGGTCGGTAAGCCATAGTGGCCCT
CTGACGCTGTCCTAGGATCTTGTTGAACGCTCGGAAGAAGTCGGACATAAATCCTGGTTCCCGATCGTGCCGAATTACCTCGCTTGCGCCAAATCGGCGG
AACACACATTCTTCGTAGGATTCCGCTATCGTTTGAGCCGTCCTGGATGAGCTGGCCTTGGCCATCACATAGCCAGTGAACAGATCAACCCAGATCAGCA
ACTCCGTGTTGCCTCTATGCGATTTCGGCAGCGAAGGTATGTGATCCATGGCTATGATCTGGAACGGATAGGTGGCTGGATATTCCCTGGCGACTCGCCT
CGGATAGTTGGCCGACCTTTTCCGGTCTCGCAGTCTACACATTCCCCAACATACCGTTGGACACTCCGGTACAGGCCTCTCCAGTGGAAGTGATCTCGGA
TCCGCTGGTAAGTGCGGCCGATCCCTTGGTGGCCTCCCTCTACACTAGCATGGTAGTGGTGCAGGATATCCTGATGGAGGGTTTCGGGTGCAACCAACCG
CATCGCGAGATCTCGATCTTCGTCAGACTTCCGGTTTGGTGGACAGTAGAAGAGTAATCCGTCCAGATCCATCTCGTAATCCATTGCCAGATTGCTGTAG
GATCGAGCTTCTTCCTGGGCCAAGTAGCTACATCGCCAGCCAGATACTTCTTCATTCCGGCGATCCATGACTCTTCATCTTGGGCCCGACGAATTCGCTC
TATCCTGAGCTCCCTCACCAATTCTTCCTGCATTACCTTCGGACTAGATCCGGATCTGACTCCAGATCGGGTGTCACCGGCGAAACCGGACCACGGATTC
TTCGGACTGTACGGTTAGAATCTCGTCCAACCGGTTTAGGGTCACCAAATCCGGATAGTCTTCCTCGTCCACTAGGATCCCGACTGTCGCTGAAGGGCAG
CTCCGGCGAGGCTGTCAGCGGAACCATTCCAGTCTCGCTTAACATGTAGCAGTTCGTGATCTGGCCACTCTCGCACTCGATCTAGAGCTTTCTGTTTCAA
CAGAACCAAACCTGGGGCCTTACAATCAATTTCTCCTCTCACTTGCCGGATCACCAGTTGGAATCCCCGCAGATCACTAGACGTCCACGCTCCACTTCAG
CCAGGAGGTCGAAACACAACAAGAGACCATTATACTCCGCTTCATTCACCGTCATCCCTTCTGCATAACCCGATCGGGCTTTCAGCACGGTCCATTCTGG
TAGTTTCCACAGGATCGCGCTGTACGCGCCTCCTCCTCGTTTTACTCGGGCCGATCCGTCAAAGCTTACCACGTACAATTCTTCATCAGCCTTCACCGTG
GGTACAGGAGCTTGGATCTGCCGTCGGGGCTCTTTCTTAGGCGCGATCGCGATCAACGCCTCTTCCACATCGGACCTAGGTGTAATACTGGCAGCCATCG
CCCCTAGGATTTCGTCTTCCCTTTGGTGCACTTCATAATTTCAAGTGTCCATGGCGACAGAAGAGCTGCCCATTGACCCAGACGTCCCTGTAGCCCCGGC
GATCGGAACAACCATGCTAACGTCGAATGTCGAGTTAGGATCCGGATCTCACGTCCTACCAGAAGGTTGTAATTCAGATCCAAGATCCGTAGCAACGCCA
ACACTTCCTTCTCGACCACATTATAATTCAGCTCGTTCGACTTCAGTGTCCGACTGGCGAAAGTGACCGGATAGTAGATCTGATCGTGACTCTGCATCAA
GGCGGCGGAAATAGCCCATTCGCTAGCGAAGACAACTACTACTGGGAGTAAATCGGGATCGAAGTGGCGCAGAATTGGAGCGGTGGCGATCTTGTCCTTC
AACGCTGCAAACGACCTATATGCTCTGACCCATCTCTCGTCAGCTGCATCTACACCTGACATTACCGGGGTTGCAGTAGTTGAGTGGGAGATCTCGGGAT
CGGGTTCAGACGAACTGTGATCCAGGATCCGACGAAGATCTGGGCGCTTCTTCAACTCAGCGAACTCCACTTCGCGTAATTCATATAGAACGGCAGCATA
GATCGCATAGTCCTCGATAAATCGGCTGTAATAGTTCAGGCTGCCCAAAAACGACTGCATGGATCTGAGTGATCCCGGAAAAGGTAGATCCGTCAAAGTC
TTCAAGTCCTTCGGATTAGCTTCGATGCCATCGTCGGACACTCGGTGTCCCAAGTATTCCACCCGGGGAAGACCCCAGAAACTCTTCACCACACTTATAG
ACAGGTTCCATTTATCACACGCTTCGAGCAGATTCTCCACTCGGTGGCACAGTTGATCCCAAGATCCAGCTGTTACCAGGATGTCATCGATGTAGGATCT
GCGTCCTAACACTGACGGACGACCTGGATCTTCCGGTTCTCCAGCCTCAAAGGATCTGGAGCAAGTCCTGGCTCGTCAGTAGGCGGGATCCGTGTAAACC
CATATAACGCATTATCCAGAAGCCGCTGATAGATCTGAGGCGCATTCTTGAGTCCGAAAGGCATCCGGTTCCACTCGAACAAGCCGAATGGAGTTATGAA
AGCCGAGATCGCGCGAGCTCGGTCCGTCATAGGTACGACCCAAAATCCGCTTGCCATGTCCAGCGAACAGTACCAACACCTTGTTCAGATCCTCTAATAG
ATCATTGATCAGAGGCATGGGGTAGATCATTAGTCGAGTGAGACCATTCACCAGTCGGTAGTCTATACACAGCCTGATGTCGATCCCGTTCTTTTTGATG
ATCACCACGATCGGTGATGCCCACGGCGATGTCGAATGTCGAATCATCTTTGCTGACAGCAACCCCTTGATCAGATCTGACACCTTCTCCCGGAACTGCG
GTGCTATCTTCCGCACCCGTTGCACGATCGGCTTCGCACCTCCTACATCGATATCACATACGACTCCTCGGGCAGCTGGCGGTAAGGCATTACCTTTGCC
TATCACAAGTGTCGTTTCCGCCAGATGATCTGCCGCAGACGATCGATCTCATCTGGAGTGCTGCGATCTGGATCACCCACCTGGATATCGTCAATAGTCA
CTTCGCTCGTCATAGCCGTGATCTCTGGCAATACTGCCATCTCGCCTTCCACATCTTCAGCTAGCAGATCACCAGCTTCGTGGTGATAAATATGTTCATC
TTCCA