Description :
From Genome Similarity Track
Location :
Scaffold_120:32659- 34450
Transcript NameFunction/comments
Albla_Nc14075070PREDICTEDx3a hypothetical protein isoform 1

Sequence
1791 bases(100 bases per row)
GGAGAAACTGGTTCAGGAAAGACGACGCAGATGACGCAATATATGGCGGAAATGGGTCTCACTTCGAAAGGTATTGTCGGATGCACACAACCTCGTCGAG
TGGCAGCTTCTTCTGTGGCAAAACGAGTGGCAGAAGAGTTTGGGTGTGAGTTGGGTCAAGAGGTCGGGTACGCGATGCGATTTGAAGATTGCACTTCGCC
TTCGACTGTGATAAAGTACATGACAGAAGGAATGCTTCTTCGCGAGTACCTTGCCGATAATTCCTTGTACAAGTATTCCGCGCTGATGCTGGATGAGGCC
CATGAGCGAACGATTAACACGGATGTTTTATTCGGTTTGCTCAAAGATTTGGTGAAAGCGCGCCCGGGGTTCAAGCTAATTGTGACTTCGGCGACGTTGG
ATGCTGAAAAGTTTTCACGTTATTTTTTCGATTGTCCAATTTTCACGATTCCGGGACGAACATTTCCAGTGGAGATCCTCTACACCAAAGAGCCCGAAAT
GGACTATCTGGACGCTTGTCTTCTTTGTGTGATGAATATTCACCTTCAGGAACCCGAAGGCGATATACTGTTGTTTCTGACTGGGCAAGAAGAGATTGAT
ACGGCCAGTGAGATCTTGTTTCAACGGATGAAATCCTTACGCGAGCGCGTTGTGGTTCCCGAATTGATCATTTTGCCAGTGTATGGTGCGCTTCCGTCCG
AAATGCAGTCGAGAATATTCCAGCCAGCTCCCAAAGGCTCCAGAAAATGTGTGATTGCCACAAATATCGCCGAAGCTTCTCTTACAATTGATGGTATTTA
TTACGTGGTGGATCCGGGATTTTGCAAGCAAAATGTCTTTAATTCCAAGATTGGTATGGATTCTCTGGTAGTTGTGCCTTGCTCCCAAGCTTCTGCTCGA
CAACGAGCCGGGCGTGCTGGACGAACGGGCCCGGGAAAATGTTATCGGCTTTACACAGAGAATGCTTATCGGAATGAAATGCTCTCAACAACCATTCCGG
AAATCCAACGCGCCAACTTGAGTTCTGTGGTCTTGCAATTGAAGGCGATGGGCATCAACGATCTGATCAAGTTTGATTTCATGGACCCTCCACCACAACA
AGCTTTGATGATGGCGTTGGAGAATTTGTATGCTCTTGGCGCGTTGGATGAAGAAGGTCTGCTCACGCGTCTGGGCAAGAAGATGGCCGAATTTCCAGTA
GAGCCGAAAAATGCCAAAGTTCTATTGACTTCGGTTGTCTTGGGATGTACAGAGGAGGTGTTGACCATCGTGGCGATGCTTTCGGTGGAAAGTGTGTTTT
ACCGGCCGAAAGAGAAACAGAGTCAAGCTGATCAAAGAAAGGCAAAATTCCACCAGGCTGAAGGCGATCATCTGACCTTGCTATGTGTGTACCAAGCGTG
GGAGCAATCCAGATTTTCAAATGCGTGGTGCTTCGAGAACTTTATCCAGGCACGAGCTATACGAAGGGCTCAAGACGTTCGCAAACAGCTTCTTTCCATC
TTGGATCGATACAAAATGGATGTGGTTTCTTGTGGAAAGAATTATAACAAAATCCGGCGAGCAATTGTATCGGGATACTTTGTGAATACTGCGAAGAAAG
ACCCAAAAGAAGGATTCCGAACCATGGTGGAAGGCCAGCCGGTCTACACCCATCCATCCAGTGCTCTGTACCATAAGGGTCCACAATGGGTGCTGTATCA
TGAATTGGTGCTGACGACCAAGGAATACATGCGGAATGTGATGGCCATTGAGCCGAAATGGCTGGTCGAATTGGCGCCTGCGTTCTTCAAG