Description :
From Genome Similarity Track
Location :
Scaffold_57:326426- 329170
Sequence
2744 bases(100 bases per row)
TTCTCTTTCCTATGGTTCAATACAAATATCTAGTCTAGACGTGTCCGTTGTGGATCTTCCCAAGTAACCACCGACCCTTCAGAGCCTCCTCGACGCCCCA
AGAGGCCTCTCGATGACTCTATTGGACGATGAAGGGGTTCCCTGACTTGGAGCAGTCACCGGGGCTCGAACGGTCGTCTTAAGTGCGGATCTCGGGTCAA
AGTTCGCTGTAGGTTCGGATCGTACTTGAAGTTCCGGTGTTGTGTGGACACACCACGGCTTGAGCTTGAGTGTTGACGAGTCATCCTCATTGGTCCAAAC
TGGCCAATCCGCGGCCGTCGAACACCATCGAACGAATGGCGATGTGCCTCGATCCGCCAGTTTAGTCGACGCCGAATGCCGCGGGGCTTGCCGTAAGCTT
CACTCAACTTTCTCGACACCACAGCTGCCCACACCGTATCGCGAGCCACAGCACTTGGTGAGTGTCAGGGTGCTCCCGGTGTCTTCGCGCTACCACGGCT
GGGTCGTCTCGCGCCGCGAAGGCTGCGCTGGCCCGCGCGTTCCGGGCGCTCTGCGTCGATCCCGCTGACATGGTACGTGCTGCGTTCGGTCTCCTGCTCG
TGCCGTCGACTGCTCACCCTCACGCGTGTGCGCTTGTTCTGCTGGCGGCAGGCTCCCGCTGCGGTTTATGGGAGATTCGGGGGCCGACAGGCCCCCGAAC
TCCGTTAAATTTAGGTGAGATCTCCGAACTCCGGCCGCAGCCCCGGAGGGGCGCAGCCGTTTTCCCTTTATTTACCGAGAAATTGTAGCTGAGGAGTTCA
CAGTAAGCATGGCCTTGTTAGCAGCGCGCAATGATAACAAGGCAGCAGTGGTCGAGGCGGTTGGACGGCGCTCATTCCCTCCCCGTCTAGTTTATCCTGA
GGAAAAGGTGGATGACATGCAGTTGTCGCGGCTGTTTTCACGTCCGTTGTTCGTGTGGACCCCGGCGTATCGAAGAGGCAAAGGTCTGCCGTCGTGCATC
AGCCGAGACTGCAACTGCAATCCGAAGGTGAAAGACTATTGCCGTCGTGTGGTGGAATCTGTGGAGTGCAAGTGCGACCTGGTATTTGTGAAGTATAGGT
GCGCTGTAACAGGATCATATTTTCCACTGTGAGCTCGGATTACTTTGCACAATGGCCCGATATGATTTTTCACTTTCCATTTGTTCTGAGCCAAAAGCTA
GTGTTCTCGAACTCACTCATGGAGACGGTTCATGACGGTATTACCGCGCAGAATGGGTTGCAACGTACCATGGAAAATATGGAGCGTAGGCGCAAACAGC
GCTACTACAAGCTTTTGGGTCTGTTTTCCAGTGGCATCAAGCGAAACCACGAGCGTTGCTTCACCTATCTGGCCCTCACTCCAATATCAGAGGATCAGTA
TGCAGATCAAAACAAAGTTGTTGACAATCACACGCTTACGACGGCATGGCTACACGCTACAGAGCTGTACGGGTCGCTGTGTGAAAAAGTGATGAAAGAC
TGTGTTGTAAAGAGGGCCATGAGAATGGATCACTCTGTCAAGTTCTGCAAGCGGCTAAAGCTGTGGAAGGCCAAGGGGCAACGTAAATCTCTCAAAGATG
CGAAAATGCTTTTGCTGTTCCAGAATGAAATTGGGCAGATTATTGGGCGGCGGCTGACCAGGTCTGAAAACAAGGAAGAAACACGAGCCTTGCTTCAACA
TGTGAAGTCGCAGTTTCGTGCGCCTTCTGGGGGTGACCTGGATCATGTAGTTGTGTCGGATAACGCGTCGGCTGTCAAGAAAATGGTCACAGAAGTGTTT
GGTAGCGAGGTGGTCACAAAACAGGACCCCTTTCACGTGATAACTCGCATCACTGAAAAAAATAAAGGCACCCGTCACCAGCAAACGAATTTCAAAGGAA
CTCTCCCGTGCGATCTACAATGTGGATCGTGAATTGCGCCCTACTGCTGAAATGGCTCTTCAATTTCAAAGTGTAGTCAGCGGTGTTTTGCGCTCAAGTG
TATCGTGCAGCCTGAAAGAGTGGTAAGGGTTGTGTCAGAGTAATTTGGAGCAGATTCAGCGTGCGAGTTGTACGTGGGCTCAAACACTTACAGGGAAGGC
GGTCATCGAGTTCGCGTGGTATCTACTAGCCAACTTGAGGGCTTTCACTCTTCCTTAAAAAAACTTCTTACCAGAAATGTATCGATTGATGTTGGCTTGC
GGATCTTAGATTGGTTTATCGTCAAGCATAATTTGTCTATCGGTGCTAAGTTCGGGCGCAATCCGCCCATGAATGGCGTTGATTTGATTTCGGCGAGCCA
TACTGCATTACTCTGTGGAACGATGGTCCCTACTTCGCCTCAGATGGAGTATGTGATGCAGCTTTCTCTTCGCCGCTTGTACCCCCGCAGTATAGAACGG
AGACCGAGCGGGACTTAGATCGACTCCTGGGCACAGGTATTTCAAAGTGCAAGAGTGAACACAACATGTCTCGAAGGGAATCTTAATCGCTCCCGGCAAC
ACCGCTCAACAGTAGCGGAACTGCTGTTAAAAAGTGCCGTTACCCTCCAATCGGCCAAGCTGAAGCGTGACGAGTTTTTTTTAACTCTATTCGACTGGGA
AGTACCGAGTGTGAAGGCGACCAGGGCTTCTCTACGGAGGAGCACGAGCTGCTCAGGCAGCTGCGTAACGAGCAGGCTGCTAGTAAGCGTGAATGGTGCA
CGTGTGAAATGATAACAACGTTGATGTTCAATATTGGTGTTTGC