Description :
From Genome Similarity Track
Location :
Scaffold_725:3264- 6336
Transcript NameFunction/comments
Hyaar_Emoy2814475hypothetical protein

Sequence
3072 bases(100 bases per row)
GTGCTCCTTAACGGTAGTGTTGACTTCAACGTCGATCTTGGATCCCACCATGGATAAAATAAAACGGGGTATCTCCGTGGACGCGATCTTGTGCCGTATT
CATGGAGAATGTCAGGCATCCCAATCCTTCTGATCCACGTCCGTAACGTACATCTTGATCGCTCAAGTCAACGTCTGCACAATGCATTCCGCATTCCGTT
CGCTTGCGGTCGGTAAGCCNNNNNNNNNNATGCGTTCCGCGGTTCCGTTCGCTAGAGGTTGGTAAGCCATGGTTGTACGCTCCTTTGCCCTGCGATCAGG
TTAAACGCTCAAAAAAATCCGACATAAATCCAGGTTNNNNNNNNNNTTTTAATTACCGTGGCAGGAACGGGTTGTGATCCATTGCGATCACCTGAAATGG
NNNNNNNNNNTTACGGACCTCGACGAACTTTCTCTCGTGATCACGTAACCCGAGAAGAGATCCACCCATAGCAGTAGTTCAGTATTTNNNNNNNNNNTCC
GGTTGTGACGTATCGCGCCACTTGCTCCAAATCTTTGAAATAAACATTCCTCATAGCCTTCAGCGATCGCTCGTGCGGTCTTCAACGAACTTGTTCTCGC
AATCACATAACCCGAAAAGAGATCCACCCACAGCAGTAGTTCGGTGTTTCCTTTGAATGATTATGGCAGAGACGGTACATGAGCCATTGCGTTCACCTGA
AATGGGTATGTGGCCTGTATATTCCCAGGAGATCTGCCACGGATCACGAGCAACCCTTTCCCCATCGTTCAATCCACACATGCGCTAACATAACTCTGAA
TACTTCGATATAAACCTCTCCAATGGAAATTAGACTTGATTCTCTGACGTGTCTTCCCGATCCCTTGGTGACCACCTTTCAAGCTCGTATGGTAATGNNN
NNNNNNNCACAGCAGTAGCTCGGTGTTTCATTTGAATGACCGTGGTAGAGACGAGATATGATCCATTGCGATCACCTNNNNNNNNNNTGTATTCCCAGGG
GTCTGCCACGGATCGCGGGTAACCCCATTCCAGTCGTGCAGTCCACGCATTCGCTAACATGACGCTGTATACTCCGACATAGACCGCTCCAATGGAAATT
AGACCTGATCCTCTGATATATCCTCTCGATCCCTTGGTGACCACCTTTGGAGCTCGTATNNNNNNNNNNCGTGCGTATCGTGTGATCGCTGCCATCTTCA
CTACACGGTCCACCTTTTTTGGAATNNNNNNNNNNTTAGAGTCTCAGGGGCTGAAAACCAGCAATCCATTTTCATTGACTTCGTAGTCTGAAACAATCCG
AGCGCATAATTNNNNNNNNNNGGTTAAATTGTCTATAAGACATTCCTGTATGCTGGCGATCCAGATTTCTTCTTCTTGCACCTGCCTTATACGCTAGATC
CGCATCTGCTGCACTAATTTTTCCTTTTAAATTTCGGGTTGTCGACGCCTTCGCNNNNNNNNNNCGCCTGCCTTATCCGCTTGATCCACATCTGCTGCGC
TATTACTTCTTGCAGATTTTCGGTTTGTTGATGCCTTCGCTGCGCGGATCGTATGATCGCTGGCATCTTCACTATGCGGTTCACCTTTTTTGGCATAAAC
AATTCGCCTNNNNNNNNNNGGCATGAACAATTCGTCCATCCGGTTGAGTGGTATCAAATCTTGTAGCTCTTGATCTGAAGTTATAATGGTACCTTTCTTC
TGCTGCAAGTTTCCCTCGCTAGTCGATCTGCGCTTTGGTTCCACTCCTGCTTCATATGTAAGAACTCGTGGTTCGGCAATGATCGAAGTTTCTGCATCGC
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGTCACCACATACAATTAC
TCGTCCCCTAGTTTGACCATCCAGCAGGTCGAACCTCAGTAACAGACCACGAGATTCAGCTACATTCACCGTTAACTCTACTGCATATTCCGAAGCAGCC
GCGATANNNNNNNNNNCATTCTGGTGGTTTCCAAATGATCGCGCTATACGACTCACCCTTCCGTTGAGTTCGCGCCGATCCGTCGAAGCTAACAACCAAT
AGGCTCTCATACGTTTCCACCGTGGGGGTAAAATGGTTACAATATGCTTAGGTTGCTTTTTTTGGAGCGATCGCGATCACCATCTCATCTACCTCTTCTA
GAAGGATTATTCTAGCTGCGAGTGTGCCAAGTATTTCATTTCCCCCTTTTCACATCTCCTAACCTCCATTGTCCAATTCGATAGTAGCGCGGCCCATCNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTCGGGGGATTAAACAAGCCAGGATATTGTCGAATATCGAG
TGACTACCTTGATCTCCCGGGNNNNNNNNNNTCACACGCCCAAAAGTCGAAGCAAGGCTAACACCTCTTTCTCTGCCATGCCATTATTAATCTCATTTGT
CTTCGGTGTACGGCTCGTGAATGTCACCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGTTAGTAGTCTTTTCCCAC
CGGAATCTTTCATTCGGATGAAGATCACCTTCTTCTAGGGTGCTATCGCGATCTCCTGCCATCGCATCACGATCATCCATATAATTAATCTTAAAAAAAT
CTGCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTAATCCATTTTACGCCGTCTCCAAAAACTCTTGGTCAAGCTGATCGACAAATTCC