Description :
From Genome Similarity Track
Location :
Scaffold_1598:3264- 5669
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1598-fgenesh-gene-0.1NOP17

Sequence
2405 bases(100 bases per row)
GATGGACGAGGCCACGATGCTGCAGTACGCGGACGTAAGTTTGCTCTCTGGCGCTTGGCTGGACGACCCGCGTCTTCACTCTAACAACGTTGCTCTTCTT
GTCTCGTGATGACAACCATGTGCAGTGGCTGGACAACCTCGAGCGGACAGATCCGGAAGGCTACAAGCAGCTCATCGCAACGATGCAGGCGCAGATCCAG
AGCGGGGGACCGAGCGCCACTGGCGGCGGCTTTGCAGGCGCAGGTGGACACCAGGGCGACTCCGACGCTGCGCTCTTTGAAATGCTGGGCAGCACGAAAG
CTGGCGGGACTGGGACGCCAGGTAATGAGCACAGAGCACACACTATACTAGCAGTGATACGATGAGTATCACAGACCTAGGAGCTAACGAGTGACTGCCA
TGTACCAACTGTTGCTCATGTGCACTTGCCAACAGACTTCAAGCCGCGCTTCCCTGGCAACAAAGTCATGGACACGAACGGACTCGCAGCACCAGCGCAA
GAAGGGGTACGCGCAGCTGAAACTTGCTCGGCTACTACATTGAGCTGACTGATGTGGTGGTGCTGTTGTTGTGCGAAGGTCTACATTGACGTGGAGCCGG
GCTTTGTGATGAAGACGAGCGAGATCAAGAGCGGCAAAAAGGTATGGACGACGTTGCTCATGAAGTTAACAATCACATACAAGCTCATGGTGTGCGTCGT
ATGCATATGAACAGGTGTTTGTGAATGTATGCTGCTCCGAGAGCATCCAGAGCTTCTCGCAGCAAAAGAAGCTCGACGACGAGGGCAAAGAGCAGGAGGT
ATCCATGTCAACATACCTGTCTTATGATATGAGATTGAGCCCTAACCATCTAAGTTGAACCTTTATCTCCTCCTGTATATATGCATCACTACGACACCTA
GGGCATCCACGTCCCGCTCAGCCTTGGAACCCCACACGAAGTGCAGGACAAGAAAGGCGCGACGTCGCTGGCCTTCGACGTGGCCGTGAACACGCAGGTC
GTGACCGACTGCCGCGCAGACAAGACCGGCTCCTTCCGTAACTTTGTGTGCGAGCTGGCGCTCGAGTACATTGACCAGAAGGTAAAGCTCTATTGTTCTA
GATATAGCATGATTACAACAATGTCGATCTCACTCAAGGCTAACCAATATATTGATCTCCACAGTACAATATTCAGCTGGACGCGCGCTACAAGCTGCCG
CGGCTGTTGTACTGTGGCGGTCTGCCACCGCCCAAGCACTACATCCGCAAGCTGCAGGCGCCGAAGATCCAGGAAGTGACAACCAAGTTAACTGCTATCA
AGCCCAGCACCAAGCAACAACAGGCGGCAGTCGCTAAAACAGCGACCGCTCGATGCGAAATCTATGACACTGTCAAAGCGTCCAGTGAGAAAGATAGCAA
AAGAGTGCTCTGCAAGCGCGTGGCTGCGGTCGAGAGACTCGGAAAGGCGCTGTCGCCTCAGGTCCTGCGCGATACTGGTGACGAACTCGAGGTTGCTGTG
CATTTCGATGGGACTAAGAACGTGCGTTCTGCTGATGATGTGGAGCTGGAGCTTGGCCCAGAGCTGCTCTGCGTCAAGGCGCGTGGACATCACGACCTGA
GTACGTGGATCAGAGTGCGTGAAAGCGTATTGACATTTTCTTGACTGACTGAATGCTGTTGTGATGCAGATGTCTTTCTTCCATACCCGGTCTTCGTGAA
GTCCGCTCAAGTCACGCTCTACCAGTCAGCGAGCAAACTCCAGCTGAAAATGGCGATTGACAAGTCGTGGGACACTGAGAATGCAGACTGCGGCTCGGCG
CCGTGGCTTTTGGCACAGGCTCTGACCAGCGACGACATTGACGAGGAAGAAGCTCAAGTACCGAGTGCAATGGCCAAGCCAAGGTCCCTGGCGGAGTTGT
ACCAGCTCGAAGAGCCCGACGTGGGAGAACCAGCAGGCTCAAGTACGATCAAAGTAGCTCAACTAGCAAAGTGGGACCCTGTAGACGAAGACGAAGAGCT
CCCAGAGGACCGATTCCACCGCAAGGACATGATGTCGATGCACATTCTCGAGGCGCGCAAGGCCGAGCGCGAGCAGAAGGCAAAAGAGTCGGACGCGAAG
CGCAAGGTCCAGCGAGCTGAGGTCCAGGAAAAGCAGCGGAAAGCCACGGAAGCGGGGAAGACGTGGCGGGAGATGTATCCGAACGAGCCCGAGACGACGT
ACATCGACATGGAGGACATGCTGGACAAGCAGAAGGCGCGCCAGGCAGCGCAGACTAGTGCTGACAAAGTCAAAGCTCGAGGTCAAAAGCCGCAAGAGAA
GCCCGATCTGCTGCCAACGGACGATGCGATCTCAGCAGCCGCAGCATGGTCCGAGAACAAGCGAAGCGGGAAGCTGGACCTGCGCTCGGCGCTCGCGTTC
GACCT