Description :
From Genome Similarity Track
Location :
contig_47:326327- 327424
Transcript NameFunction/comments
g9700.t1XP_009523408.1 hypothetical protein PHYSODRAFT_350602 [Phytophthora sojae
g9701.t1hypothetical protein

Sequence
1097 bases(100 bases per row)
ACTTGCAGGACCATAAAATCTACGTGCAGACACGACTGGCCGAGAACAAGGATGCCATCTTCGACTTCATCATGAACGGCGAGGGATGCATCTACATTGC
TGGATCCGCGAAACGAATGCCGAACGACGTGTACGAAGTACTGCGTGACATCGTTCGCTCAGTCGGGAAGATCCCCCTGCCAACCGCCGAGAAGGTGATG
AAGACGTTGGCTCGCAAGAAGCGCTACGTCGTCGAATCTTGGTCGTAGAAACCTCATGCAGGCTAGATCAAACCAATTCAGTAGACTGCTTGGCCATCTC
GGTGCACTTCACCTTTTATGATTCGCTAAAAACACACAGACCATGTCCATGGACACCGCGCAGGAACTGGAGCAGGCGCAGCATGTGCGCACGTTCGTGA
GGCTCGCCAACCTCACGCAGACGCCTGAGCTGCACGAGTGGAACCTCGAATCCCTTCAGAGAGCTCTGCAGTGGGCTCAAGTAGCGGAAGATGTGGTGGA
TGGCAGGGAGGGCATCGAATCGCACATCCGTCGGTGGTTCCCCGTGGCGACGCTGCCGACGCTGCCTTTGGATGGGGCTCTGACAGCCGACGCCTACGCC
ATGCAAGCGTCCACTTGCTGCAGTCCATTCTGCAGAGCCCGTACATGGCGACGCATCCGACGCGGTCGGAACTGCTGGTGGCTGTGCTCCAGGAGCTCCA
AAGCAGACACGAAGACTCGTCGGCTGACGAGCTGGAAGAGCACTCTAACAGGTGACTTTGCTAGTGGCGCGGTGTGAGTGAGAGATCCTTATTTTGTTTT
TTGATGTGCTGGTAGTACGTTGCTAACGGAGAGGGTTACTGGAGCCCCACGCGCAGACTCGATGCTAGCCATTGCTCGTCGAATGAGTGAGGCTTGCAAG
CGCATTCGTGTGCAAGGTAATTGTCTCTGTCGCAATGTGGTGCAATGAGTGATACTGACGCGTTCGTGCAAATGAAGTGCTTTCTGGCTGGATCCTGGTG
CCTCCACTAAAGAGTTACGCACTATCACCACGCACGCTTCAGCTAAAGGCTATGGCGAAAACGTTGCAACGAAATGCAGTGGATGCTCGTGCGGCTG